Incorporating mitogenome sequencing into integrative taxonomy: The multidisciplinary redescription of the ciliate Thuricola similis (Peritrichia, Vaginicolidae) provides new insights into the evolutionary relationships among Oligohymenophorea subclasses

Liao, Wanying; Campello-Nunes, Pedro H.; Gammuto, Leandro; Viana, Tiago Abreu; Marchesini, Roberto; Paiva, Thiago da Silva; Silva‐Neto, Inácio Domingos da; Modeo, Letizia; Petroni, Giulio

doi:10.1016/j.ympev.2021.107089

Cited by 7 publications

(5 citation statements)

References 110 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…similis, collected from Cuoiodepur WWTP (Liao et al, 2021), while in the present work, we provide the characterization of B. subtropica, a ciliate presenting a conflict in species identification. Our improved description is based on a multidisciplinary study, where results obtained from the different applied analyses have been compared and integrated (see below).…”

Section: Identity Of the Ciliate Species Found In Cuoiodepur Wwtpmentioning

confidence: 99%

See 1 more Smart Citation

Ciliated protozoa from industrial WWTP activated sludge: a biodiversity survey including trophic interactions and redescription ofBakuella subtropica(Spirotrichea, Hypotrichia) according to Next Generation Taxonomy

Liao

Serra

Gammuto

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

Optimization of wastewater treatment with biological processes is a fundamental challenge of modern society. During past years new technologies have been developed for the purpose and prokaryotic organisms involved in the process extensively investigated. Nevertheless, relatively few studies so far analysed the protozoan community in these systems using modern integrative approaches, despite its obvious role in shaping ecological dynamics and, possibly, process efficiency. In the present study, we characterized the ciliate community in biological reactors of an Italian industrial (tannery) wastewater treatment plant (WWTP) applying modified Ludzack-Ettinger (MLE) process. This plant is characterized by moderate salinity, high solids retention time and high concentration of organic compounds, including a significant recalcitrant fraction. We performed the morphological and 18S rDNA characterizations of almost all the 21 ciliates retrieved along a one-year sampling period, and provided preliminary data on species occurrence, community dynamics, and trophic interactions. Only 16 species were observed on the sample collection day and most of them had an occurrence higher than 50%. The most frequently occurring and highly abundant organisms were Aspidisca cf. cicada, Euplotes spp., Paramecium calkinsi, and Phialina sp. Cyclidium cf. marinum was only found on a single date and its presence was possibly related to a summer break-induced perturbation. All the species showed the capability to survive the short oxic/anoxic cycling typical of the studied WWTP process. Intriguingly, some of them (i.e., Bakuella subtropica and Trochiliopsis australis) turned out to be species isolated from brackish natural environment rich in organic load as well. As for B. subtropica, we provided an emended redescription according to the most recent taxonomy standards that include also mitogenomic sequencing.

show abstract

Section: Identity Of the Ciliate Species Found In Cuoiodepur Wwtpmentioning

confidence: 99%

“…S1C, D; 2P), and T. similis (see Liao et al, 2021) were identified through both molecular (Table 1) and morphological (on living and stained material) characterizations. Even though we failed to obtain the 18S rRNA gene sequence of A.…”

Section: Identity Of the Ciliate Species Found In Cuoiodepur Wwtpmentioning

confidence: 99%

Ciliated protozoa from industrial WWTP activated sludge: a biodiversity survey including trophic interactions and redescription ofBakuella subtropica(Spirotrichea, Hypotrichia) according to Next Generation Taxonomy

Liao

Serra

Gammuto

et al. 2021

Preprint

Self Cite

View full text Add to dashboard Cite

show abstract

“…The DNeasy® Blood and Tissue kit (QIAGEN) was used to extract genomic material. Subsequently, the PCR method using the protocol described by Liao et al (2021) and specific primers Peri_57F (5´ CATGCATGTGTAAGTATAAGTA) and Peri_1385R (5´ CGGTGTGTACATTTGC) were employed to amplify the 18S-rRNA gene. The PCR products were purified using the QIAquick PCR Purification Kit -Qiagen, and then sequenced by a specialized company.…”

Section: Introductionmentioning

confidence: 99%

High infestation and phylogenetic position of Epistylis sp. (Ciliophora, Peritrichia) on Aegla serrana Buckup & Rossi (Crustacea, Anomura) from southern Brazil

SOUZA,

DIAS,

LOURES

et al. 2024

An. Acad. Bras. Ciênc.

View full text Add to dashboard Cite

High infestations of epibiont ciliates on vertebrates or invertebrates are normally related to aquaculture tanks or similar environments, and the importance of this relationship in natural habitats is often disregarded. Here, we describe the first record of high infestation of ciliates on Aegla serrana in South America and conduct a brief morphological and phylogenetic characterization of these ciliates. Our findings confirm that cases of high infestation of ciliates on metazoans can indeed occur in natural environments.

show abstract

“…The order Sessilida Kahl, 1933, which comprises about 105–140 genera and more than 800 species, is widely distributed in aquatic environments and has attracted the intertest of researchers for almost 350 years (Foissner et al 1992 , 2010 ; Kahl 1935 ; Lynn 2008 ; Nenninger 1948 ; Stiller 1971 ). In recent decades, researchers have been investigating new ways to identify species, e.g., using silver staining methods, and exploring their molecular systematics, mostly using ribosomal DNA (rDNA) gene sequence data (Li et al 2008a ; Liao et al 2021 ; Miao et al 2004 ; Sun et al 2016 ). As more rDNA sequences of sessilids have become available, the classifications of some families have been queried (Lu et al 2023 ; Wang et al 2022c ).…”

Section: Introductionmentioning

confidence: 99%

“…Tong Wu and Ting Cheng have contributed equally to this work. DNA (rDNA) gene sequence data (Li et al 2008a;Liao et al 2021;Miao et al 2004;Sun et al 2016). As more rDNA sequences of sessilids have become available, the classifications of some families have been queried (Lu et al 2023;Wang et al 2022c).…”

Section: Introductionmentioning

confidence: 99%

On four epibiotic peritrichous ciliates (Protozoa, Ciliophora) found in Lake Weishan Wetland: morphological and molecular data support the establishment of a new genus, Parapiosoma gen. nov., and two new species

Wu,

Cheng,

Cao

et al. 2023

Mar Life Sci Technol

View full text Add to dashboard Cite

During a study on the diversity of ciliated protists in Lake Weishan Wetland, the largest wetland in northern China, four epibiotic sessilid peritrichs were isolated from aquatic host animals. Two of them, i.e., Epistylis cambari Kellicott, 1885 and Epistylis lwoffi Fauré-Fremiet, 1943, were known species whereas the other two, i.e., Parapiosoma typicum gen. nov., sp. nov. and Orborhabdostyla gracilis sp. nov., are new to science. The new genus Parapiosoma gen. nov. is characterized by its branched non-contractile stalk, everted peristomial lip, obconical macronucleus and transverse silverlines. Two species are assigned to the new genus, namely Parapiosoma typicum sp. nov. and Parapiosoma gasterostei (Fauré-Fremiet, 1905) comb. nov. Morphologically, P. typicum sp. nov. is recognized by its goblet-shaped zooids, single-layered peristomial lip, dichotomously branched stalk, and infundibular polykinety 3 (P3) containing three equal-length rows. Orborhabdostyla gracilis sp. nov. is characterized by its slender zooid, curved macronucleus, and three equal-length rows in infundibular P3. Improved diagnoses and redescriptions of E. cambari and E. lwoffi are provided including, for the first time, data on the ciliature of E. cambari. Phylogenetic analyses based on SSU rDNA, ITS1-5.8S rDNA -ITS2, and LSU rDNA sequence data strongly support the assertion that the family Epistylididae comprises morphospecies with different evolutionary lineages and indicate that Parapiosoma gen. nov. may represent a new taxon at family level.

show abstract

Incorporating mitogenome sequencing into integrative taxonomy: The multidisciplinary redescription of the ciliate Thuricola similis (Peritrichia, Vaginicolidae) provides new insights into the evolutionary relationships among Oligohymenophorea subclasses

Cited by 7 publications

References 110 publications

Ciliated protozoa from industrial WWTP activated sludge: a biodiversity survey including trophic interactions and redescription ofBakuella subtropica(Spirotrichea, Hypotrichia) according to Next Generation Taxonomy

Ciliated protozoa from industrial WWTP activated sludge: a biodiversity survey including trophic interactions and redescription ofBakuella subtropica(Spirotrichea, Hypotrichia) according to Next Generation Taxonomy

High infestation and phylogenetic position of Epistylis sp. (Ciliophora, Peritrichia) on Aegla serrana Buckup & Rossi (Crustacea, Anomura) from southern Brazil

On four epibiotic peritrichous ciliates (Protozoa, Ciliophora) found in Lake Weishan Wetland: morphological and molecular data support the establishment of a new genus, Parapiosoma gen. nov., and two new species

Contact Info

Product

Resources

About