In Vivo Replication of an ICP34.5 Second-Site Suppressor Mutant following Corneal Infection Correlates with In Vitro Regulation of eIF2α Phosphorylation

Abstract

In animal models of herpes simplex virus type 1 (HSV-1) infection, ICP34.5-null viruses are avirulent and also fail to grow in a variety of cultured cells due to their inability to prevent RNA-dependent protein kinase (PKR)-mediated inhibition of protein synthesis. We show here that the inability of ICP34.5 mutants to grow in vitro is due specifically to the accumulation of phosphorylated eIF2␣. Mutations suppressing the in vitro phenotype of ICP34.5-null mutants have been described which map to the unique short region of the HSV-1 genome, resulting in dysregulated expression of the US11 gene. Despite the inability of the suppressor mutation to suppress the avirulent phenotype of the ICP34.5-null parental virus following intracranial inoculation, the suppressor mutation enhanced virus growth in the cornea, trigeminal ganglia, and periocular skin following corneal infection compared to that with the ICP34.5-null virus. The phosphorylation state of eIF2␣ following in vitro infection with the suppressor virus was examined to determine if in vivo differences could be attributed to differential regulation of eIF2␣ phosphorylation. The suppressor virus prevented accumulation of phosphorylated eIF2␣, while the wild-type virus substantially reduced eIF2␣ phosphorylation levels. These data suggest that US11 functions as a PKR antagonist in vivo, although its activity may be modulated by tissuespecific differences in translation regulation.

Inhibition of the Host Translation Shutoff Response by Herpes Simplex Virus 1 Triggers Nuclear Envelope-Derived Autophagy

“…To determine whether NEDA is caused as a response to the effect of ␥34.5 on macroautophagy and/or protein translation, we used two mutant viruses displaying specific mutations in the ␥34.5 protein. The first one lacks the beclin-1-binding domain (the ⌬beclin-1 virus) (12,13,20,21), while the second one contains two point mutations interfering with PP1␣ binding (the ⌬PP1␣ virus) (Fig. 3A).…”

“…The HSV-1 17ϩ ⌬␥34.5 and HSV-1 17ϩ ⌬beclin-1 (⌬aa68-87) viruses have been previously described (12,13,20,21). The HSV-1 17ϩ ⌬PP1␣ virus that carries Val178Glu and Phe180Leu substitutions was constructed by amplifying nucleotides 463 to 1088 of HSV-1 by PCR from wild-type (wt) strain 17synϩ infectious DNA with primers 5=-CAGACC ACCAGGTGGCGCACCCGGACGTGGGGCGATAAGCGCTCCCGCG CGGGGGTC-3= and 5=-GCACATGCTTGCCTGTCAAACTCT-3=.…”

Functional Genomic Analysis of Herpes Simplex Virus Type 1 Counteraction of the Host Innate Response

“…The IFN resistance of HSV-1 is attributed at least in part to ICP34.5-PP1 interaction (7). The specificity of PKR in this process has been demonstrated through restoration of ICP34.5-null virus growth to wild-type levels in PKR Ϫ/Ϫ mice and PKR Ϫ/Ϫ MEFs, as well as MEFs expressing eIF2␣-S51A, a nonphosphorylatable form of eIF2␣ (7,33,54,59).…”

Replication of Herpes Simplex Virus 1 Depends on the γ 1 34.5 Functions That Facilitate Virus Response to Interferon and Egress in the Different Stages of Productive Infection

“…Paradoxically, a ␥ 1 34.5 null mutant with a secondary mutation in the U S 11 promoter region inhibits PKR activity but nevertheless remains avirulent (11,39,40). The virus is cleared a few days after ocular infection in experimental mice (47). Moreover, a ␥ 1 34.5 null mutant with an additional mutation in the other regions of the viral genome partially restores virulence (10).…”