In vivo persistence and protective efficacy of the Bacille Calmette Guérin vaccine overexpressing the HspX latency antigen

Spratt, Joanne M.; Britton, Warwick J.; Triccas, James A.

doi:10.4161/bbug.1.1.10027

Cited by 19 publications

(18 citation statements)

References 20 publications

(25 reference statements)

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…However, during the course of infection there was a dramatic 2.5 log 10 reduction in CFU and MPN counts of mycobacteria in the lungs of infected animals ( Figure 1A). These results are in good accordance with previously reported survival patterns of M. bovis BCG in BALB/c mice (8,9). In contrast, the number of mycobacteria grown with culture supernatant changed only at the beginning of infection (a 0.5 log 10 reduction 1 wk postinfection) and at later stages it remained constant, suggesting that more than 98% of mycobacteria recovered from lungs at 6 weeks postinfection required special conditions for cultivation ( Figure 1A).…”

supporting

confidence: 82%

The In Vivo Environment Accelerates Generation of Resuscitation-Promoting Factor–Dependent Mycobacteria

Turapov

Glenn

Kana

et al. 2014

Am J Respir Crit Care Med

View full text Add to dashboard Cite

supporting

confidence: 82%

The In Vivo Environment Accelerates Generation of Resuscitation-Promoting Factor–Dependent Mycobacteria

Turapov

Glenn

Kana

et al. 2014

Am J Respir Crit Care Med

View full text Add to dashboard Cite

“…M. bovis BCG does not replicate in BALB/c mice, and after several weeks of infection most bacilli are cleared from murine lungs (32, 33). Therefore, this model may be considered an in vivo model of bacterial survival under conditions nonpermissive for growth.…”

Section: Resultsmentioning

confidence: 99%

Antimicrobial Treatment Improves Mycobacterial Survival in Nonpermissive Growth Conditions

Turapov

Waddell

Burke

et al. 2014

Antimicrob Agents Chemother

View full text Add to dashboard Cite

Antimicrobials targeting cell wall biosynthesis are generally considered inactive against nonreplicating bacteria. Paradoxically, we found that under nonpermissive growth conditions, exposure of Mycobacterium bovis BCG bacilli to such antimicrobials enhanced their survival. We identified a transcriptional regulator, RaaS (for regulator of antimicrobial-assisted survival), encoded by bcg1279 (rv1219c) as being responsible for the observed phenomenon. Induction of this transcriptional regulator resulted in reduced expression of specific ATP-dependent efflux pumps and promoted long-term survival of mycobacteria, while its deletion accelerated bacterial death under nonpermissive growth conditions in vitro and during macrophage or mouse infection. These findings have implications for the design of antimicrobial drug combination therapies for persistent infectious diseases, such as tuberculosis.

show abstract

“…A PacI-restricted fragment containing the selection genes lacZ and sacB was obtained from pGOAL17 (26) and cloned into the pYUB854-PCR5=-3= construct to obtain the final delivery vector pYUB854-ureC. M. tuberculosis CDC1551 bacteria were electroporated with 1 g of the UV-irradiated plasmid solutions as described previously (35). Hygromycin-resistant (Hyg r ) white colonies were selected, and deletion at the correct locus was verified by PCR using 2 sets of primers overlapping the deleted region (set 1, TGCGCCTCAATCATCCGGAGG [forward] and CACGAGCAGACCTCACTAGC [reverse]; set 2, ACTGC TTGTCCGATATCTGAT [forward] and TCTGCTCGCACAGTTCGGA CA [reverse]) and Southern blot analysis (see method below).…”

Section: Methodsmentioning

confidence: 99%

Urease Activity Represents an Alternative Pathway for Mycobacterium tuberculosis Nitrogen Metabolism

et al. 2012

View full text Add to dashboard Cite

dUrease represents a critical virulence factor for some bacterial species through its alkalizing effect, which helps neutralize the acidic microenvironment of the pathogen. In addition, urease serves as a nitrogen source provider for bacterial growth. Pathogenic mycobacteria express a functional urease, but its role during infection has yet to be characterized. In this study, we constructed a urease-deficient Mycobacterium tuberculosis strain and confirmed the alkalizing effect of the urease activity within the mycobacterium-containing vacuole in resting macrophages but not in the more acidic phagolysosomal compartment of activated macrophages. However, the urease-mediated alkalizing effect did not confer any growth advantage on M. tuberculosis in macrophages, as evidenced by comparable growth profiles for the mutant, wild-type (WT), and complemented strains. In contrast, the urease-deficient mutant exhibited impaired in vitro growth compared to the WT and complemented strains when urea was the sole source of nitrogen. Substantial amounts of ammonia were produced by the WT and complemented strains, but not with the urease-deficient mutant, which represents the actual nitrogen source for mycobacterial growth. However, the ureasedeficient mutant displayed parental colonization profiles in the lungs, spleen, and liver in mice. Together, our data demonstrate a role for the urease activity in M. tuberculosis nitrogen metabolism that could be crucial for the pathogen's survival in nutrientlimited microenvironments where urea is the sole nitrogen source. Our work supports the notion that M. tuberculosis virulence correlates with its unique metabolic versatility and ability to utilize virtually any carbon and nitrogen sources available in its environment.

show abstract

In vivo persistence and protective efficacy of the Bacille Calmette Guérin vaccine overexpressing the HspX latency antigen

Cited by 19 publications

References 20 publications

The In Vivo Environment Accelerates Generation of Resuscitation-Promoting Factor–Dependent Mycobacteria

The In Vivo Environment Accelerates Generation of Resuscitation-Promoting Factor–Dependent Mycobacteria

Antimicrobial Treatment Improves Mycobacterial Survival in Nonpermissive Growth Conditions

Urease Activity Represents an Alternative Pathway for Mycobacterium tuberculosis Nitrogen Metabolism

Contact Info

Product

Resources

About