In Vitro Selection and Characterization of DNA Aptamers Specific for Phospholamban

Abstract

Calcium transport across the membrane of the sarcoplasmic reticulum (SR) plays an important role in the regulation of heart muscle contraction and relaxation. The sarco(endo)plasmic reticulum Ca 2ϩ ATPase (SERCA) 2a is responsible for Ca 2ϩ uptake by this organelle and is inhibited in a reversible manner by phospholamban, another SR membrane protein. Thus, alleviation of phospholamban-mediated inhibition of SERCA2a is a potential therapeutic option for heart failure and cardiomyopathy. We have now applied the systematic evolution of ligands by exponential enrichment protocol to a library of singlestranded DNA molecules containing a randomized 40-nucleotide sequence to isolate aptamers that bind phospholamban. One of the obtained aptamers, designated Apt-9, was found to specifically bind to the cytoplasmic region of phospholamban in vitro with high affinity (dissociation constant, ϳ20 nM). Apt-9 increased the Ca 2ϩ -dependent ATPase activity of cardiac SR vesicles but not that of SR vesicles from skeletal muscle in a concentration-dependent manner. It also shifted the Ca 2ϩ concentration-response curve for this ATPase activity to the left. These effects of Apt-9 were not mimicked by an oligonucleotide with a scrambled version of the Apt-9 sequence. Thus, our results indicate that Apt-9 activates SERCA2a by alleviating the inhibitory effect of phospholamban on this ATPase, and they suggest that phospholamban-specific aptamers warrant further investigation as potential therapeutic agents for heart failure and cardiomyopathy.Calcium transport across the membrane of cardiac SR plays an important role in the regulation of contraction and relaxation of heart muscle. SERCA2a is a membrane protein of the cardiac SR that possesses Ca 2ϩ -dependent ATPase activity. SERCA2a is responsible for Ca 2ϩ uptake by this organelle, and its activity is modulated by phospholamban, another SR membrane protein (Tada and Katz, 1982;Fleischer and Inui, 1989;James et al., 1989;MacLennan and Kranias, 2003). The dephosphorylated form of phospholamban inhibits SERCA2a by reducing its apparent affinity for Ca 2ϩ (Inui et al., 1986). Phosphorylation of phospholamban by cAMP-dependent protein kinase alleviates its inhibition of SERCA2a, with the consequent increase in the Ca 2ϩ -pumping activity of SERCA2a resulting in acceleration of muscle relaxation and enhancement of cardiac contractility. This mechanism of SERCA2a regulation underlies the positive inotropic effect of ␤-adrenergic receptor stimulation Sham et al., 1991;Luo et al., 1994).Evidence suggests that the expression of SERCA2a is reduced in the failing heart, with an increase in the inhibitory effect of phospholamban on Ca 2ϩ -pumping activity (Hoshijima et al., 2006). Excessive inhibition of SERCA2a by mutant forms of phospholamban was shown to impair cardiac contractility and relaxation in mice, resulting in heart failure and cardiomyopathy (Zhai et al., 2000;Zvaritch et al., 2000;Haghighi et al., 2001). Conversely, ablation of phospholamban rescued the impairment in cardi...

Rheostatic Regulation of the SERCA/Phospholamban Membrane Protein Complex Using Non-Coding RNA and Single-Stranded DNA oligonucleotides

“…Aberrant interactions between SERCA and PLN mutants and concomitant Ca 2+ mishandling have been correlated with dysfunctional contractility and heart disease 7 8 . As a result, several approaches have been pursued to reverse these conditions; not only SERCA gene transfer therapy 4 9 10 , but also siRNA 11 , miRNA inhibition 12 and aptamers 13 14 , have shown promise as therapeutic avenues. In particular, SERCA-directed gene therapy is the most effective strategy to augment Ca 2+ transport and muscle contractility, either using an adeno-associated virus to overexpress the ATPase in cardiomyocytes or targeting PLN to reverse SERCA inhibition 10 .…”

Cotinine-conjugated aptamer/anti-cotinine antibody complexes as a novel affinity unit for use in biological assays

“…For application of aptamers in multiple assays and experiments, biotin labeling has been the most commonly adopted option to avoid the need to develop optimal aptamer cross-linking conditions for multiple enzymes, dyes, or sensors individually (Murphy et al, 2003; Baldrich et al, 2005; Li et al, 2009; Tanaka et al, 2009). Because biotin is stable and small (molecular weight of 244.31 kDa), it rarely interferes with the function of labeled molecules.…”

“…However, because the cross-linking conditions to one enzyme, dye, or sensor cannot be applied to other targets, the determination of specific conditions for aptamer cross-linking to multiple enzymes, dyes, or sensors is a time-consuming process. Therefore, labeling of aptamers with biotin to produce complexes with avidin, streptavidin, or neutravidin in various cross-linked forms has been commonly employed when an aptamer is to be applied to multiple assays (Murphy et al, 2003; Baldrich et al, 2005; Li et al, 2009; Tanaka et al, 2009). Additionally, aptamers have been labeled with digoxigenin to produce complexes with anti-digoxigenin antibodies (Ramos et al, 2007, 2010).…”

Discovery of Aptamer Ligands for Hepatic Stellate Cells Using SELEX

“…The in vitro SELEX was performed as previously reported (Figure 1 ) 22 . The single-stranded DNA library was amplified by PCR using Taq-polymerase with a forward primer containing the T7 promoter (underlined): 5'- TAATACGACTCACTATAGGG -AGAGTGCTGTTACTATCG-3' and a reverse primer 5'-ATACCACCTTGTTCAGTT-3'.…”