In Situ Profiling of the Three Dominant Phyla Within the Human Gut Using TaqMan PCR for Pre-Hospital Diagnosis of Gut Dysbiosis

Abstract

A microbial imbalance called dysbiosis leads to inflammatory bowel disease (IBD), which can include ulcerative colitis (UC). Fecal microbiota transplantation (FMT), a novel therapy, has recently been successful in treating gut dysbiosis in UC patients. For the FMT technique to be successful, the gut microbiota of both the healthy donors and UC patients must be characterized. For decades, next-generation sequencing (NGS) has been used to analyze gut microbiota. Despite the popularity of NGS, the cost and time constraints make it difficult to use in emergency services and activities related to the periodic monitoring of microbiota profile alterations. Hence, in this study, we developed a multiplex TaqMan qPCR assay (MTq-PCR) with novel probes to simultaneously determine the relative proportions of the three dominant microbial phyla in the human gut: Bacteroidetes, Firmicutes, and Proteobacteria. The relative proportions of the three phyla in fecal samples of either healthy volunteers or UC patients were similar when assessed NGS and the MTq-PCR. Thus, our MTq-PCR assay could be a practical microbiota profiling alternative for diagnosing and monitoring gut dysbiosis in UC patients during emergency situations, and it could have a role in screening stool from potential FMT donors.

Alterations and Prediction of Functional Profiles of Gut Microbiota After Fecal Microbiota Transplantation for Iranian Recurrent Clostridioides difficile Infection with Underlying Inflammatory Bowel Disease: A Pilot Study

“…PCR was implemented according to the conditions described previously. 19 Briefly, the PCR mixture consisted of 25 μL Emerald AMP GT PCR 1× Master Mix (Takara Bio, Shiga, Japan), 1 μL (10 μM) of each barcoded PCR primer pair, 1 μL of DNA template (1–50 ng DNA) and 22 μL of ultrapure water. The samples were incubated at 95°C for 5 min, followed by 35 cycles of 95°C for 30 s, 57°C for 30 s, and 72°C for 30 s, and finally 72°C for 5 min.…”

In Vitro Fermentation Evaluation of Engineered Sense and Respond Probiotics in Polymicrobial Communities

“…A multiplex assay was used to quantify the amounts of general bacteria (Eub518 probe), Escherichia (Pro probe), Bacteroidetes (Bat1 probe), and Firmicutes (Fir probe) in all samples as described previously. 50 In a separate multiplex reaction, the abundances of L. acidophilus (La) and L. plantarum (Lp) were also quantified for all of the Lp reactors. La primers were as follows: ATGGAAAAGGTTGGCCA forward primer (UniLac-toHsp60FOR1), TCAGTTACCATGTATTGTGACA reverse primer (UniLactoHsp60REV1), TCGAAGATTCACGTGGTATCAATAC probe (LAcidophTaq3FOR).…”

Alteración de la microbiota intestinal y su relación con enfermedades gastrointestinales y hepatobiliares

“…Los niveles de transcripción de proteína y ARNm de las moléculas de las uniones estrechas, se pueden evaluar con transferen-cia Western blott y PCR cuantitativa, respectivamente, así mismo por RT-qPCR y por una prueba desarrollada recientemente llamada Multiplex TaqMan qPCR (MTq-PCR) [38,[40][41][42]. En Colombia, está disponible una prueba de secuenciación metagenómica a través de la tecnología NGS (del inglés, Next-Generation Sequencing), la cual realiza un análisis del microbioma intestinal mediante la secuenciación de la totalidad del material genético (ADN), lo que la hace un marcador indirecto de permeabilidad intestinal [43].…”