In Silico and Experimental Characterization of Chimeric Bacillus thermocatenulatus Lipase with the Complete Conserved Pentapeptide of Candida rugosa Lipase

Abstract

Lipases are one of the highest value commercial enzymes as they have broad applications in detergent, food, pharmaceutical, and dairy industries. To provide chimeric Bacillus thermocatenulatus lipase (BTL2), the completely conserved pentapeptide (¹¹²Ala-His-Ser-Gln-Gly¹¹⁶) was replaced with similar sequences (²⁰⁷Gly-Glu-Ser-Ala-Gly²¹¹) of Candida rugosa lipase (CLR) at the nucleophilic elbow region. For this purpose, three mutations including A112G, H113E, and Q115A were inserted in the conserved pentapeptide sequence of btl2 gene. Based on the crystal structures of 2W22, the best structure of opened form of the chimeric lipases were garnered using the MODELLER v9.10 software. The native and chimeric lipases were docked to a set of ligands, and a trial version of Molegro Virtual Docker (MVD) software was used to obtain the energy values. Docking results confirmed chimeric lipase to be better than the native lipase. Following the in silico study, cloning experiments were conducted and expression of native and chimeric btl2 gene in Pichia pastoris was performed. The native and chimeric lipases were purified, and the effect of these mutations on characteristics of chimeric lipase studied and then compared with those of native lipase. Chimeric lipase exhibited 1.6-fold higher activity than the native lipase at 55 °C. The highest percentage of both lipases activity was observed at 60 °C and pH of 8.0. The ion Ca²⁺ slightly inhibited the activity of both lipases, whereas the organic solvent enhanced the lipase stability of chimeric lipase as compared with the native lipase. According to the results, the presence of two glycine residues at the conserved pentapeptide region of this chimeric lipase (¹¹²Gly-Glu-Ser-Ala-Gly¹¹⁶) may increase the flexibility of the nucleophilic elbow region and affect the enzyme activity level.

Study the effect of F17S mutation on the chimeric Bacillus thermocatenulatus lipase

“…The pKHT.E plasmid containing chimeric btl2 gene (previous work) was used as a template for generating mutated btl2 gene using site-directed mutagenesis, as described previously [16]. The mutated btl2 gene was generated by PCR using the F17S forward (5′- GA TGGCCA TGGCGGCATCCCCACGCGCCAATGATGCACCCATCGTGCTTCTCCATGGG TCC ACAGGATGGGGGCGAGAG-3′, Mlu NI site and point mutation are underlined) and F17S reverse (5′- TT GAGCTC ATCATC CCTTCATTAAGGC -3′, Sac I site) primers.…”

“…Lipase activity was determined by triacylglycerol substrates in pH-STAT (Metrohm Ltd., Herisau, Switzerland) at 55 °C (pH 9.5). For substrate specificity, 2 mg/ml of various substrate, including tributyrin (C4), tricaprylin (C8), tricaprin (C10), trilaurin (C12), trimyristin (C14), tripalmitin (C16), and olive oil (C18) were emulsified in distilled water containing Arabic gum (20 mg/ml) using ultrasonic treatment (Hielscher GmbH, Teltow, Germany) for 5 min at maximum power [16].…”

Optimized Production of Biodiesel from Waste Cooking Oil by Lipase Immobilized on Magnetic Nanoparticles

“…Thermal inactivation is critical for both reusability and storage stability. One possible approach for improvement is to use thermally stable lipases [39,40]. Because large amount of lipase-bound MNP was used for the transesterification, those away from the magnetic field were easily washed off during recycling.…”

Identification of a Novel Lipase with AHSMG Pentapeptide in Hypocreales and Glomerellales Filamentous Fungi

“…The pentapeptide is essential for lipase activity; however, little is known about its role in catalytic performance [ 11 ]. In order to explore its function, Hosseini et al (2013) [ 12 ] replaced the pentapeptide AHSMG in the lipase BTL2 of Bacillus thermocatenulatus with the pentapeptide GGSAG, found in CRL lipase of Candida rugosa . It was observed that the native AHSMG-lipase retained 50% of its activity after 60 min at 65 °C, 80% at pH 9, and about 75% at pH 10.…”