Improvements to gene deletion in the fungal pathogen Cryptococcus neoformans: Absence of Ku proteins increases homologous recombination, and co-transformation of independent DNA molecules allows rapid complementation of deletion phenotypes

Goins, Chelsey L.; Gerik, Kimberly J.; Lodge, Jennifer K.

doi:10.1016/j.fgb.2006.02.007

Cited by 112 publications

(105 citation statements)

References 23 publications

Supporting

Mentioning

100

Contrasting

Unclassified

Order By: Relevance

“…Multiple deletion strains were created (Table 1) either by sequential biolistic transformation (see above) (19,51) or by mating followed by random spore selection (18).…”

Section: Methodsmentioning

confidence: 99%

Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans

Baker¹,

et al. 2007

Self Cite

View full text Add to dashboard Cite

Cryptococcus neoformans is an opportunistic fungal pathogen that causes cryptococcal meningoencephalitis, particularly in immunocompromised patients. The fungal cell wall is an excellent target for antifungal therapies as it is an essential organelle that provides cell structure and integrity, it is needed for the localization or attachment of known virulence factors, including the polysaccharide capsule, melanin, and phospholipase, and it is critical for host-pathogen interactions. In C. neoformans, chitosan produced by the enzymatic removal of acetyl groups from nascent chitin polymers has been implicated as an important component of the vegetative cell wall. In this study, we identify four putative chitin/polysaccharide deacetylases in C. neoformans. We have demonstrated that three of these deacetylases, Cda1, Cda2, and Cda3, can account for all of the chitosan produced during vegetative growth in culture, but the function for one, Fpd1, remains undetermined. The data suggest a model for chitosan production in vegetatively growing C. neoformans where the three chitin deacetylases convert chitin generated by the chitin synthase Chs3 into chitosan. Utilizing a collection of chitin/polysaccharide deacetylase deletion strains, we determined that during vegetative growth, chitosan helps to maintain cell integrity and aids in bud separation. Additionally, chitosan is necessary for maintaining normal capsule width and the lack of chitosan results in a "leaky melanin" phenotype. Our analysis indicates that chitin deacetylases and the chitosan made by them may prove to be excellent antifungal targets.

show abstract

“…Multiple deletion strains were created (Table 1) either by sequential biolistic transformation (see above) (19,51) or by mating followed by random spore selection (18).…”

Section: Methodsmentioning

confidence: 99%

Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans

Baker¹,

et al. 2007

Self Cite

View full text Add to dashboard Cite

show abstract

“…To reconstitute the gcn5⌬ mutant strain with the wild-type allele, the GCN5 locus was amplified from H99 genomic DNA and biolistically cotransformed into the gcn5⌬ strain with a separately amplified neomycin resistance allele to create strain TOC3, as previously described (28). The wild-type GCN5 allele was amplified with primers 5Ј ATGGTACCAGCAATGAAGAC 3Ј and 3Ј AAAGGA TGCAGGTGAACTTA 5Ј, and the neomycin allele was amplified with the M13 forward and reverse primers from the plasmid pJAF1 (23).…”

Section: Methodsmentioning

confidence: 99%

Cryptococcus neoformans Histone Acetyltransferase Gcn5 Regulates Fungal Adaptation to the Host

et al. 2010

View full text Add to dashboard Cite

Cryptococcus neoformans is an environmental fungus and an opportunistic human pathogen. Previous studies have demonstrated major alterations in its transcriptional profile as this microorganism enters the hostile environment of the human host. To assess the role of chromatin remodeling in host-induced transcriptional responses, we identified the C. neoformans Gcn5 histone acetyltransferase and demonstrated its function by complementation studies of Saccharomyces cerevisiae. The C. neoformans gcn5⌬ mutant strain has defects in high-temperature growth and capsule attachment to the cell surface, in addition to increased sensitivity to FK506 and oxidative stress. Treatment of wild-type cells with the histone acetyltransferase inhibitor garcinol mimics cellular effects of the gcn5⌬ mutation. Gcn5 regulates the expression of many genes that are important in responding to the specific environmental conditions encountered by C. neoformans inside the host. Accordingly, the gcn5⌬ mutant is avirulent in animal models of cryptococcosis. Our study demonstrates the importance of chromatin remodeling by the conserved histone acetyltransferase Gcn5 in regulating the expression of specific genes that allow C. neoformans to respond appropriately to the human host.

show abstract

“…KN99␣ and KN99a, well-characterized congenic strains of C. neoformans serotype A, were used as the wild-type strains (39). The PKC1 deletion strain was generated in KN99a (39); cku80⌬ KN99␣, which displays enhanced homologous recombination of transforming DNA (17); and the Mpk1 Flag-tagged strain (this study). H99 and the mpk1⌬ strain in the serotype A background were kindly provided by Joseph Heitman at Duke University (28).…”

Section: Methodsmentioning

confidence: 99%

PKC1 Is Essential for Protection against both Oxidative and Nitrosative Stresses, Cell Integrity, and Normal Manifestation of Virulence Factors in the Pathogenic Fungus Cryptococcus neoformans

Gerik¹,

Bhimireddy²,

Ryerse³

et al. 2008

Eukaryot Cell

Self Cite

103

155

View full text Add to dashboard Cite

Cell wall integrity is crucial for fungal growth, survival, and pathogenesis. Responses to environmental stresses are mediated by the highly conserved Pkc1 protein and its downstream components. In this study, we demonstrate that both oxidative and nitrosative stresses activate the PKC1 cell integrity pathway in wild-type cells, as measured by phosphorylation of Mpk1, the terminal protein in the PKC1 phosphorylation cascade. Furthermore, deletion of PKC1 shows that this gene is essential for defense against both oxidative and nitrosative stresses; however, other genes involved directly in the PKC1 pathway are dispensable for protection against these stresses. This suggests that Pkc1 may have multiple and alternative functions other than activating the mitogen-activated protein kinase cascade from a "top-down" approach. Deletion of PKC1 also causes osmotic instability, temperature sensitivity, severe sensitivity to cell wall-inhibiting agents, and alterations in capsule and melanin. Furthermore, the vital cell wall components chitin and its deacetylated form chitosan appear to be mislocalized in a pkc1⌬ strain, although this mutant contains wild-type levels of both of these polymers. These data indicate that loss of Pkc1 has pleiotropic effects because it is central to many functions either dependent on or independent of PKC1 pathway activation. Notably, this is the first time that Pkc1 has been implicated in protection against nitrosative stress in any organism.

show abstract

Improvements to gene deletion in the fungal pathogen Cryptococcus neoformans: Absence of Ku proteins increases homologous recombination, and co-transformation of independent DNA molecules allows rapid complementation of deletion phenotypes

Cited by 112 publications

References 23 publications

Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans

Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans

Cryptococcus neoformans Histone Acetyltransferase Gcn5 Regulates Fungal Adaptation to the Host

PKC1 Is Essential for Protection against both Oxidative and Nitrosative Stresses, Cell Integrity, and Normal Manifestation of Virulence Factors in the Pathogenic Fungus Cryptococcus neoformans

Contact Info

Product

Resources

About