Improvement of lentiviral transfer vectors using cis-acting regulatory elements for increased gene expression

Abstract

Lentiviral vectors are an important tool for gene delivery in vivo and in vitro. The success of gene transfer approaches relies on high and stable levels of gene expression. To this end, several molecular strategies have been employed to manipulate these vectors towards improving gene expression in the targeted animal cells. Low gene expression can be accepted due to the weak transcription from the majority of available mammalian promoters; however, this obstacle can be in part overcome by the insertion of cis-acting elements that enhance gene expression in various expression contexts. In this work, we created different lentiviral vectors in which several posttranscriptional regulatory elements, namely the Woodchuck hepatitis posttranscriptional regulatory element (WPRE) and different specialized poly(A) termination sequences (BGH and SV40) were used to develop vectors leading to improved transgene expression. These vectors combine the advantages of restriction enzyme/ligation-independent cloning eliminating the instability and recombinogenic problems occurring from traditional cloning methods in lentiviral expression vectors and were tested by expressing GFP and the firefly Luciferase reporter gene from different cellular promoters in different cell lines. We show that the promoter activity varies between cell lines and is affected by the lentiviral genomic context. Moreover, we show that the combination of the WPRE element with the BGH poly(A) signal significantly enhances transgene expression. The vectors herein created can be easily modified and adapted without the need for extensive recloning making them a valuable tool for viral vector development.

Including the p53 ELAV‐like protein‐binding site in vector cassettes enhances transgene expression in rat submandibular gland

“…Previously, we have shown that the human EF1α promoter had considerable activity in rat submandibular glands, roughly 10% that seen with the common and robust CMV promoter (Zheng and Baum, 2005). It has also been reported that use of the BGH poly A, versus the more commonly used SV40 poly A, could increase transgene expression (Yew et al , 1997; Xu et al , 2002; Azzoni et al , 2007; Real et al , 2011). Accordingly, herein, the EF1α promoter was used to drive luciferase reporter gene expression, along with the BGH poly A, in the plasmid pACEF1α‐luc‐BGH (Figure 1a).…”

CHK1 overexpression in T-cell acute lymphoblastic leukemia is essential for proliferation and survival by preventing excessive replication stress

“…57 The selected CHEK1 shRNA (target sequence 5′-CCGGG TGGTTTATCTGCATGGTATTCTCGAGAATACCATGCAGATAAACCACTTTTT-3′), validated by the RNAi Consortium as the best hairpin (98% knockdown) and the control hairpin (a scramble sequence against GFP) lentiviruses were produced as described previously. 58 Viral titers of 2.5-3.75 × 10 7 /ml, determined as in Barde et al, 59 warranted a high efficiency of infection, avoiding puromycin selection. Jurkat cells were transduced by spin infection with polybrene and lentivirus (multiplicity of infection = 10) and viability was monitored daily thereafter.…”

Induction of Hantaan virus-specific immune responses in C57BL/6 mice by immunization with a modified recombinant adenovirus containing the chimeric gene, GcS0.7

“…An earlier vaccination study using DNA vaccines that include either CAG or WPRE demonstrated that compared with conventional CMV vectors, the vaccines including CAG or WPRE increased immune responses to increased antigen expression (21). The WPRE has been shown to enhance transgenic expression driven from a series of different promoters in various vector and cell types at the post-transcriptional level (10,18). However, certain studies have shown conflicting, even opposing effects of the WPRE due to differences between cell lines and promoters (29).…”

“…The woodchuck hepatitis virus (WHV) contains a post-transcriptional regulatory element (WPRE) (17), which increases the stability and extranuclear transport of mRNA to the cytoplasm, resulting in enhanced protein production. Several studies have shown that WPRE increases transgenic expression from a variety of viral vectors (18)(19)(20). An earlier vaccination study using DNA vaccines that include either CAG or WPRE demonstrated that compared with conventional CMV vectors, the vaccines including CAG or WPRE increased immune responses to increased antigen expression (21).…”