IMPROVEMENT OF EARLY MATURITY IN RICE VARIETY BY MARKER ASSISTED BACKCROSS BREEDING OF Hd2 GENE

Abstract

Early-maturing and high-yielding rice variety is very useful for increasing rice production in Indonesia. The aim of this research was to develop new lines of Indonesian rice containing Hd2 gene using Code variety as a recipient parent and Nipponbare variety as a donor parent through targetted MAB approach using RM1362 and RM7601 in chromosom 7 for foreground selection. After two generations of backcrossing, the positive alleles of Hd2 gene from Nipponbare had successfully trans-ferred into Code. The plant number CdNp_29 in BC2F2 popula-tion had the highest genome recovery of 82.7%. The twelve BC2F3 plants were selected for self-pollination to generate BC2F4. These selected lines that carried the Hd2 gene were screened in the greenhouse for the evaluation of heading date and agronomic traits. All improved lines had Hd2 gene similar to the donor parent Nipponbare. The heading date of the breeding lines ranged from 73 to 89 days (Code 85 days) or fill the third criterion of rice maturity that is 103-104 days compared to Code of 116-119 days, whereas their agronomic performances were similar with that of Code. Application of MABc for im-proving rice early maturity has accelerated the development and selection in early generation of superior lines having genetic background of Code. It is expected that the newly developed lines of Code will be utilized to increase rice production in Indonesia.

Field Evaluation Of Conde Progenies With Early Heading Date And Resistance To Bacterial Leaf Blight

“…Six lines flowered earlier 5 days than Conde in Sukamandi and three lines flowered earlier 3 days in Maros. In line with Prasetiyono et al (2014) reported that the earliest flowering line in the improved Ciherang was 4 days earlier than Ciherang. Yamamoto et al (1998) reported that large variation in days to heading of Hd2 was observed in the population of crossing between Nipponbare and Kasalath.…”

“…SSR Primer RM20582 (F: AGAGCGTCGTCCTTCACCATCC and R: GGCCAATACGACGATACATTACACG) linked to Xa7 locus located on chromosome 6 at the genetic distance of 118,5 cM (Chen et al, 2008). For the background selection: two hundred and fourty three polymorphic SSR primers distributed on 12 chromosomes (Fatimah et al, 2014) were used for background selection. Amplified products was separated by electrophoresis in 8% polyacrylamide gel (Dual Triple-Wide Mini-Vertical System, C.B.S.…”

“…Furthermore, early maturity allows farmers to increase their cropping intensity from two to three cropping of rice per year in tropical regions. Breeding for high yielding rice varieties with early maturity is considered important to increase cropping indexes in the fully irrigated farm lands (Fatimah et al, 2014;Pramudyawardani et al, 2015).…”

“…It derived from IR64, an existing popular variety, this variety is well accepted by farmers and consumers (Toenniessen, 2003;Jena & Mackill, 2008). The improvement of Conde rice variety that containing Xa7 gene was transferred with Hd2 gene from Nipponbare for earliness heading date and productivity has already developed through Marker Assisted Backcrossing approach (MABc) (Fatimah et al, 2014;Fatimah et al, 2018). MABc is using markers to select for target loci (donor), minimize the length of the donor segment containing a target locus, and/or accelerate the recovery of the recurrent parent genome during backcrossing (Hospital, 2001).…”

Genetic Parameter Evaluation on Advanced Generations of A Cross to Improve Magelang Local Black Rice Cultivars

“…Local black rice cultivars often have low yield potential (3-4 Mg per ha) (Fatimah et al, 2014;Wiranti et al, 2015), higher plant habit, and long harvesting date (≥ 150 days) (BB Padi, 2009). Improving black rice cultivar can be done by crossing it with superior cultivars with better agronomic characteristics.…”