Improved PCR-RFLP for the Detection of Diminazene Resistance in Trypanosoma congolense under Field Conditions Using Filter Papers for Sample Storage

Vitouley, H.; Mungube, E. O.; Allegye-Cudjoe, Emmanuel; Diall, O.; Bocoum, Z.; Diarra, B.; Randolph, Thomas F.; Bauer, Burkhard; Clausen, Peter‐Henning; Geysen, Dirk; Sidibé, Issa; Bengaly, Zakaria; Bossche, Peter Van Den; Delespaux, V.

doi:10.1371/journal.pntd.0001223

Cited by 25 publications

(9 citation statements)

References 6 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…There was high variability in the DIM treatment failures across the study villages. Indeed, molecular analysis using PCR-RFLP technique of filter paper blood samples collected during the drug sensitivity test confirmed presence of DIM resistant T. congolense populations in the study area [ 31 ]. A slightly higher percentage of treatment failure (36.8%) after DIM treatment was observed in the Kénéndougou Province of Burkina Faso [ 8 ].…”

Section: Discussionmentioning

confidence: 99%

Detection of multiple drug-resistant Trypanosoma congolense populations in village cattle of south-east Mali

et al. 2012

Self Cite

View full text Add to dashboard Cite

BackgroundTsetse fly-transmitted African animal trypanosomosis causes annual losses that run into billions of dollars. The disease is assumed to cause hunger and poverty in most sub-Saharan countries since it represents a serious impediment to sustainable livestock production. Both a cross-sectional and a longitudinal study were carried out from November to December 2007 to evaluate trypanosomosis risk and susceptibility of trypanosomes to trypanocidal drug treatment in village cattle populations in south-east Mali.MethodsEight purposively selected villages participated in the study. In each village, eight traps deployed along drainage lines over 24hour duration were used to catch tsetse. One hundred systematically selected cattle in the study villages were examined for trypanosomes. All trypanosome-positive cattle were randomly allocated into two treatment groups: a group treated with 0.5 mg/kg bw. isometamidium chloride (ISMM) and a group treated with 3.5 mg/kg bw. diminazene aceturate (DIM). The cattle were monitored for trypanosomes at day 14 and 28 post-treatment.ResultsOf the 796 cattle examined, 125 (15.7%) were trypanosome-positive. Village trypanosome prevalences ranged between 11% and 19%. There were no significant (p > 0.05) differences in the village trypanosome prevalences. Trypanosoma congolense was the dominant trypanosome species accounting for 73% (91/125) of the infections and T. vivax the remainder. Twenty (31.7%) of the 63 cattle on 0.5 mg/kg bw. ISMM treatment were still positive14 days post-treatment. Of the 43 aparasitaemic cattle monitored to day 28, 25.6% (11) became parasitaemic, resulting in a cumulative failure rate of 49.2% (31/63). Trypanosoma congolense accounted for 77.4% (24/31) of failed ISMM treatments. The 62 cattle treated with 3.5 mg/kg bw. DIM resulted in 30.6% (19/62) failed treatments. Although 42.2% (19/45) of T. congolense positive cattle did not respond to DIM treatment, all T. vivax positive cattle responded positively to DIM treatment.ConclusionsThe overreliance on trypanocides in the control of trypanosomosis will ultimately lead to multiple drug-resistant trypanosome populations as detected in villages in south-east Mali rendering the use of drugs doubtful. Effective alternative methods for trypanosomosis control ought to substitute chemotherapy to ensure sustainable cattle production in these villages. Since there is no single strategy for containing trypanocidal drug resistance, promotion of an integrated approach combining proven trypanosomosis control approaches in high trypanosomosis risk areas is most desirous. The best-bet strategy this study recommended for areas with multiple drug resistance included area-wide community tsetse control, control of co-infections to exploit self-cure against resistant trypanosome populations and the rational use of trypanocidal drugs which should be urgently promoted at all levels as a way of containing or reversing resistance.

show abstract

Section: Discussionmentioning

confidence: 99%

Detection of multiple drug-resistant Trypanosoma congolense populations in village cattle of south-east Mali

et al. 2012

Self Cite

View full text Add to dashboard Cite

show abstract

“…Using the second capillary tube, PCV values were determined as previously described [ 7 ] and all samples with equal to or less than 26 % PCV values were placed onto a labelled FTA® card (Whatman no 4, Whatman®, UK) as buffy coat spots for DNA extraction according to the manufacturer’s suggested protocol. All FTA® cards were dried and stored in envelopes at room temperature away from sunlight until [ 20 ].…”

Section: Methodsmentioning

confidence: 99%

Prevalence of pathogenic trypanosomes in anaemic cattle from trypanosomosis challenged areas of Itezhi-tezhi district in central Zambia

et al. 2015

View full text Add to dashboard Cite

BackgroundThe measure of anaemia status using packed cell volume (PCV) can be a reliable indicator of African trypanosomosis (AT) in the absence of other anaemia-causing conditions. However, studies that have estimated prevalence of anaemia in cattle from AT endemic areas have rarely reported the prevalence of the disease in the anaemic cattle. Therefore we investigated the prevalence of AT in anaemic cattle at sites that had recently reported the disease in Itezhi tezhi district of central Zambia.MethodsDuring a survey, blood samples were collected from 564 randomly selected cattle for anaemia determination from seven crush pens (Mutenda, Kapulwe, Banachoongo, Itumbi, Iyanda, New Ngoma and Shinampamba). At a PCV- value cut off of 26 %, all samples positive for anaemia were subjected to both parasitological examination on thick and thin blood smears and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for detection of trypanosome DNA. Fisher’s exact test and a mixed effect logistic regression analyses were used to determine and measures associations, respectively.ResultsOf 564 cattle screened, 58 (10.3 %; 95 % CI: 7.8–12.8 %) had anaemia. PCR-RFLP results showed that 17 (29.3 %; 95 % CI; 17.2–41.4 %) anaemic cattle were positive for pathogenic trypanosomes compared to 1 (1.7 %; 95 % CI: 0.0–5.2 %) on parasitological examination using thick smears. The infections were caused by Trypanosoma congolense and Trypanosoma vivax. Fisher’s exact test showed a strong association between PCV and pathogenic trypanosome infection (P = 0.004). A mixed effect multivariate logistic regression showed that a one unit increase in PCV reduced the likelihood of detecting AT with PCR-RFLP by 24.7 % (95 % CI: 4.6–40.6 %; P = 0.019) in anaemic cattle, taking into account their age and sex, with random effects for crush pen.ConclusionThese results suggest that T. congolense and T. vivax could be important causes of anaemia in cattle reared in AT endemic areas of Itezhi tezhi in Central Zambia. This also suggests that even though pathogenic trypanosomal infection was strongly associated with PCV, it could only account for up to 41 % of the anaemia in cattle. Therefore further investigation to ascertain other factors responsible for anaemia in AT endemic areas of Itezhi tezhi in Central Zambia is needed.

show abstract

“…The PCR and analysis of the amplicon was done using the method described by Vitouley et al [23] but without the whole genome amplification step. In brief, a standard PCR was conducted on DNA samples using the following primers (Ade2F ATAATCAAAGCTGCCATGGATGAAG and Ade2R GATGACTAACAATATGCGGGCAAAG) and a Sigma thermocycler®.…”

Section: Methodsmentioning

confidence: 99%

“…The Dpn II-PCR-RFLP was performed on the 34 isolates to check for the presence of the mutation in the P2-type purine transporter gene that is associated with resistance to DA [11] . The PCR and analysis of the amplicon was done using the method described by Vitouley et al [23] but without the whole genome amplification step. In brief, a standard PCR was conducted on DNA samples using the following primers (Ade2F ATAATCAAAGCTGCCATGGATGAAG and Ade2R GATGACTAACAATATGCGGGCAAAG ) and a Sigma thermocycler®.…”

Section: Methodsmentioning

confidence: 99%

High Prevalence of Drug Resistance in Animal Trypanosomes without a History of Drug Exposure

et al. 2011

Self Cite

View full text Add to dashboard Cite

BackgroundTrypanosomosis caused by Trypanosoma congolense is a major constraint to animal health in sub-Saharan Africa. Unfortunately, the treatment of the disease is impaired by the spread of drug resistance. Resistance to diminazene aceturate (DA) in T. congolense is linked to a mutation modifying the functioning of a P2-type purine-transporter responsible for the uptake of the drug. Our objective was to verify if the mutation was linked or not to drug pressure.Methodology/Principal FindingsThirty-four T. congolense isolates sampled from tsetse or wildlife were screened for the DA-resistance linked mutation using DpnII-PCR-RFLP. The results showed 1 sensitive, 12 resistant and 21 mixed DpnII-PCR-RFLP profiles. This suggests that the mutation is present on at least one allele of each of the 33 isolates. For twelve of the isolates, a standard screening method in mice was used by (i) microscopic examination, (ii) trypanosome-specific 18S-PCR after 2 months of observation and (iii) weekly trypanosome-specific 18S-PCR for 8 weeks. The results showed that all mice remained microscopically trypanosome-positive after treatment with 5 mg/kg DA. With 10 and 20 mg/kg, 8.3% (n = 72) and 0% (n = 72) of the mice became parasitologically positive after treatment. However, in these latter groups the trypanosome-specific 18S-PCR indicated a higher degree of trypanosome-positivity, i.e., with a unique test, 51.4% (n = 72) and 38.9% (n = 72) and with the weekly tests 79.2% (n = 24) and 66.7% (n = 24) for 10 and 20 mg/kg respectively.Conclusion/SignificanceThe widespread presence of the DA-resistance linked mutation in T. congolense isolated from wildlife suggests that this mutation is favourable to parasite survival and/or its dissemination in the host population independent from the presence of drug. After treatment with DA, those T. congolense isolates cause persisting low parasitaemias even after complete elimination of the drug and with little impact on the host's health.

show abstract

Improved PCR-RFLP for the Detection of Diminazene Resistance in Trypanosoma congolense under Field Conditions Using Filter Papers for Sample Storage

Cited by 25 publications

References 6 publications

Detection of multiple drug-resistant Trypanosoma congolense populations in village cattle of south-east Mali

Detection of multiple drug-resistant Trypanosoma congolense populations in village cattle of south-east Mali

Prevalence of pathogenic trypanosomes in anaemic cattle from trypanosomosis challenged areas of Itezhi-tezhi district in central Zambia

High Prevalence of Drug Resistance in Animal Trypanosomes without a History of Drug Exposure

Contact Info

Product

Resources

About