Improved detection of prunus necrotic ringspot virus by the polymerase chain reaction

Abstract

The reverse transcription-polymerase chain reaction (RT-PCR) technique was used for detection of prunus necrotic ringspot virus in dormant peach trees which tested negative by ELISA. Total RNA extracted from bark tissue, using a lithium chloride based method, were used for reverse transcription and subsequent amplification of viral sequences. The PCR product, about 300 base pairs in size, was analyzed by gel electrophoresis and visualized by ethidium bromide staining. In some cases, PCR products were not clearly visible in the stained gel and became distinct only following hybridisation with a 32p-labelled virus specific probe. The RT-PCR assay described in this paper is sensitive enough for detection of PNRSV in dormant woody bark tissue and could be incorporated into testing protocols during post-entry quarantines for rapid initial screening of imported budwood and in virus elimination programs.

Characterization of hypovirulent isolates of the chestnut blight fungus, Cryphonectria parasitica from the Marmara and Black Sea regions of Turkey

“…About 100 mg mycelium of C. parasitica, prepared as described above, was grinded in liquid nitrogen and 5 volume buffer (200 mM Tris-HCl pH 8.5, 1.5 % SDS, 300 mM lithium chloride, 10 mM EDTA, 1 % sodium deoxycholate, 1 % Igepal and 0.5 % mercaptoethanol) was added to each sample (Spiegel et al 1996). The extract was collected and heated for 15 min at 65°C.…”

In Vitro Elimination of PPV from Infected Apricot Shoot Tips via Chemotherapy and Cryotherapy

“…RNA was isolated from leaves excised from PPV-infected tree in which in vitro cultures were initiated (positive control) and chemo-(both quercetin and ribavirin) and cryotreated samples according to Spiegel et al (1996). One-step RT-PCR was carried out according to Wetzel et al (1991) with using P1 (5′ ACCGAGACCACTACACTCCC 3′) and PM (species-specific, 5′ CTTCAACAA CGCCTGTGCGT 3′) for chemo-treated; P1 and P2 (5′ CAGACTACAGCCTCGCCAGA 3′) primers amplifying C-end of the coat protein (CP) gene for cryo-treated samples.…”

Inter-laboratory evaluation of a duplex RT-PCR method using crude extracts for the simultaneous detection of Prune dwarf virus and Prunus necrotic ringspot virus

“…In this context certification schemes worldwide are being established with the objective of identifying healthy sources for propagation. Numerous molecular methods based on hybridization or PCR have been developed to detect these viruses at low concentration limits (Crosslin et al 1992;Hammond et al 1998;Rosner et al 1997;Sánchez-Navarro et al 2005;Spiegel et al 1996).…”