Impact of Renal Denervation on Atrial Arrhythmogenic Substrate in Ischemic Model of Heart Failure

Abstract

BackgroundMyocardial infarction increases the risk of heart failure (HF) and atrial fibrillation. Renal denervation (RDN) might suppress the development of atrial remodeling. This study aimed to elucidate the molecular mechanism of RDN in the suppression of atrial fibrillation in a HF model after myocardial infarction.Methods and Results HF rabbits were created 4 weeks after coronary ligation. Rabbits were classified into 3 groups: normal control (n=10), HF (n=10), and HF‐RDN (n=6). Surgical and chemical RDN were approached through midabdominal incisions in HF‐RDN. Left anterior descending coronary artery in HF and HF‐RDN was ligated to create myocardial infarction. After electrophysiological study, the rabbits were euthanized and the left atrial appendage was harvested for real‐time polymerase chain reaction analysis and Trichrome stain. Left atrial dimension and left ventricular mass were smaller in HF‐RDN by echocardiography compared with HF. Attenuated atrial fibrosis and tyrosine hydroxylase levels were observed in HF‐RDN compared with HF. The mRNA expressions of Cav1.2, Nav1.5, Kir2.1, KvLQT1, phosphoinositide 3‐kinase, AKT, and endothelial nitric oxide synthase in HF‐RDN were significantly higher compared with HF. The effective refractory period and action potential duration of HF‐RDN were significantly shorter compared with HF. Decreased atrial fibrillation inducibility was noted in HF‐RDN compared with HF (50% versus 100%, P<0.05).Conclusions RDN reversed atrial electrical and structural remodeling, and suppressed the atrial fibrillation inducibility in an ischemic HF model. The beneficial effect of RDN may be related to prevention of the downregulation of the phosphoinositide 3‐kinase/AKT/endothelial nitric oxide synthase signaling pathway.

Fisetin Alleviates Atrial Inflammation, Remodeling, and Vulnerability to Atrial Fibrillation after Myocardial Infarction

“…Regard-ing the relationship between AF and AERP, some studies considered that AERP was shortened in some models, including rapid atrial pacing 35,36) and early phage of MI (< 45 minutes) model, 37) but AERP was prolonged in longterm MI model (four weeks). 29,38) Therefore, the result of IACT and AERP prolongation we obtained in the longterm MI model was reasonable. Interestingly, shortening the PR interval suggested that fisetin can improve atrioventricular conduction.…”

YAP promotes the proliferation of neuroblastoma cells through decreasing the nuclear location of p27Kip1 mediated by Akt

“…The relative levels of mRNA expression were represented as Δ C t = C t gene‐ C t reference, and the fold change of gene expression was calculated using the 2 −ΔΔ C t method. The primers used in this study were synthesized by Sangon Biotech and presented as follows: Akt , 5′‐ATGGCACCTTCATTGGCTAC‐3′ and 5′‐CCCAGCAGCTTCAGGTACTC‐3′; CDK5 , 5′‐CGCCGCGATGCAGAAATACGAGAA‐3′ and 5′‐TGGCCCCAAAGAGGACATC‐3′; CRM1 , 5′‐CTCGTCAGCTGCTTGATTTC‐3′ and 5′‐CTCTTGTCCAAGCATCAGGA‐3′; β ‐actin, 5′‐ATAGCACAGCCTGGATAGCAACGTAC‐3′ and 5′‐CACCTTCTACAATGAGCTGCGTGTG‐3′.…”

Synergy of pulmonary vein isolation and catheter renal denervation in atrial fibrillation complicated with uncontrolled hypertension: Mapping the renal sympathetic nerve and pulmonary vein (the pulmonary vein isolation plus renal denervation strategy)?

“…A number of experimental studies investigated the mechanism underlying the potential antiarrhythmic effects of RDN. As summarized in Table , these basic studies demonstrated that, beyond BP reduction, RDN can prevent atrial electrophysiological changes, reverse atrial electrical and structural remodeling further reduce AF inducibility and AF episodes via modulating renal sympathetic nervous activity . The favorable antiarrhythmic effects independent of BP lowering were also observed at human research level .…”

“…As summarized in Table 6, these basic studies demonstrated that, beyond BP reduction, RDN can prevent atrial electrophysiological changes, reverse atrial electrical and structural remodeling further reduce AF inducibility and AF episodes via modulating renal sympathetic nervous activity. [36][37][38][39][40][41][42][43][44][45][46][47][48][49] The favorable antiarrhythmic effects independent of BP lowering were also observed at human research level. 50 Collectively, these mechanism investigations provide in-depth and rational explanations for the positive clinical outcome of the present study.…”