Impact of Altered Actin Gene Expression on Vinculin, Talin, Cell Spreading, and Motility

Abstract

Previous studies have demonstrated a strong correlation between the expression of vinculin and the shape and motility of a cell (Rodriguez Fernandez et al., 1992a, b, 1993). This hypothesis was tested by comparing the expression of vinculin and talin with the motility of morphologically altered myoblasts. These mouse C2 myoblasts were previously generated by directly perturbing the cell cytoskeleton via the stable transfection of a mutant-form of the beta-actin gene (beta sm) and three different forms of the gamma-actin gene; gamma, gamma minus 3'UTR (gamma delta'UTR), and gamma minus intron III (gamma delta IVSIII) (Schevzov et al., 1992; Lloyd and Gunning, 1993). In the case of the beta sm and gamma-actin transfectants, a two-fold decrease in the cell surface area was coupled, as predicted, with a decrease in vinculin and talin expression. In contrast, the gamma delta IVSIII transfectants with a seven-fold decrease in the cell surface area showed an unpredicted slight increase in vinculin and talin expression and the gamma delta 3'-UTR transfectants with a slight increase in the cell surface area showed no changes in talin expression and a decrease in vinculin expression. We conclude that changes in actin gene expression alone can impact on the expression of vinculin and talin. Furthermore, we observed that these actin transfectants failed to show a consistent relationship between cell shape, motility, and the expression of vinculin. However, a relationship between talin and cell motility was found to exist, suggesting a role for talin in the establishment of focal contacts necessary for motility.

Differential Regulation of Actin Depolymerizing Factor and Cofilin in Response to Alterations in the Actin Monomer Pool

“…Both genes lead to down-regulation of the endogenous ␤-and ␥-actin genes and a similar decrease in cell surface area (6, 31). In addition, both genes produce down-regulation of the tropomyosin isoforms Tm2,3 (10), and the focal adhesion proteins vinculin and talin (11). No significant difference in the level of ADF expression (as a percentage of total protein) was found in either the high or low expressing clones resulting from transfection of the human ␥-actin gene (Fig.…”

“…The ability of an actin mutant to specifically down-regulate ADF suggests the existence of a unique regulatory pathway linking ADF with an unknown aspect of actin function. The specificity of this pathway is highlighted by the finding that ␤ sm -and ␥-actin transfections parallel each other in all aspects except ADF regulation (6,10,11,31). We doubt, however, that ADF is responding to the decreased levels of normal actin per se because the binding studies suggest that ADF can equally bind normal and ␤ sm -actin.…”

“…Both wild type and ␤ sm -actin gene transfections can change both the protein and mRNA levels of endogenous actins, selective tropomyosins, vinculin, talin, and now ADF (6,10,11,31). In contrast, transfection of gene constructs encoding vinculin, ␣-actinin, Tm-1, and gelsolin, which all impact on cell morphology, do not affect the expression of other microfilament associated products (12,13,15,16).…”

“…High level expression of different human actin genes in mouse C2 cells impacts on the expression and organization of different tropomyosin isoforms (10) and on the expression of vinculin and talin (11). Vinculin expression is also decreased by drugs that depolymerize actin, and vinculin down-regulation requires the presence of a nucleus (8).…”

Splicing of Two Internal and Four Carboxyl-terminal Alternative Exons in Nonmuscle Tropomyosin 5 Pre-mRNA Is Independently Regulated during Development

“…9d 3Ј-UTR-A 1,500-bp probe corresponding to the entire 9d 3Ј-UTR, pMMTm5-3ЈUT, and generated from a mouse Tm5 nonmuscle cDNA by PCR amplification has been characterized previously (28). Two other probes, 3ЈUT244, corresponding to the 5Ј end of the 9d 3Ј-UTR (bp 760 to 1190), and 3ЈUT110, corresponding to the central region of the 9d 3Ј-UTR (bp 1200 to 1800), were generated by PCR amplification using the following pairs of primers: 5Ј GAGATGTAGACCTTCCCCATC 3Ј/5Ј GTATCCATTAGGCTAAGATGTGC 3Ј and 5Ј ATGGAGGAGAAACA-CAGGAATG 3Ј/5Ј GAAGATTTCGCCAGCACTGAC 3Ј.…”