Impact of a conservation agriculture system on soil characteristics, rice yield, and root-parasitic nematodes in a Cambodian lowland rice field

Suong, Malyna; Chapuis, Élodie; Leng, Vira; Tivet, Florent; Waele, Dirk De; Thị, Huế Nguyễn; Bellafiore, Stéphane

doi:10.21307/jofnem-2019-085

Cited by 10 publications

(7 citation statements)

References 51 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The age of rice and soil pH might influence nematode abundance, where greater numbers of nematodes extracted from rice stubbles were observed at soil pH 5.9 -6.0 than soil pH 5.3 -5.4. These results were similar to those reports by [11,18,20] who examined Hirschmanniella populations in paddy rice fields of Takeo, Battambang and Kampong Thom provinces, Cambodia. In addition, as Hirschmanniella are migratory endoparasites by nature, they are more prevalent in rice roots than in soil [21].…”

Section: Resultssupporting

confidence: 92%

“…The PCR was conducted by using extracted nematode DNA as the template. 30 µL of PCR reaction included 3 µL of DNA template, 9 µL of sterilized distilled water, 1.5 µL of each 10 µM forward and reverse primers {D2A (5′ ACAAGTACCGTGAGGGAAAGT 3′) and D3B (5′ TGCGAAGGAACCAGCTACTA 3′) [17] and rDNA2 (5'-TTGATTACGTCCCTGCCCTTT-3') and rDNA1.58s (5'-ACGAGCCCGAGTGATCCACCG-3') [18]}, and 15 µL of 2x PCR master mix with dye solution i-taq (Intron biotechnology, Korea). The PCR condition was programmed as follows: denaturation at 94 °C for 5 min, followed by 35 cycles of 94 °C for 30 s, 56 °C for 30 s and 72 °C for 1 min, and final extension at 72 °C for 5 min.…”

Section: Molecular Identificationmentioning

confidence: 99%

See 1 more Smart Citation

Incidence and Characterization of Rice Root Nematodes, Hirschmanniella mucronata, from Rice Fields in Pathum Thani Province, Thailand

et al. 2021

View full text Add to dashboard Cite

The rice root nematodes, Hirschmanniella oryzae and H. mucronata, are serious and widespread threats to global rice production, especially in tropical and subtropical zones. Reliable and efficient identification of these nematodes is vital to nematode control and management. In this current study, 36 soil or rice root samples were collected from rice fields located in Pathum Thani province and used for nematode extraction. The results demonstrated that Hirschmanniella sp. was found in all paddy fields, especially in Muang District, where RD47 rice cultivars were grown at soil pH of 5.9. Molecular identification based on the analysis of 28S rRNA and 18S-ITS1-1.58S genes revealed 98 – 99 % similarity to H. mucronata, and its phylogenetic trees were grouped with H. mucronata from Cambodia and Philippines. Likewise, the morphometric characterization revealed remarkable features of H. mucronata with long body (1,639 - 2,329 µm), long stylet (24 - 27 µm) and an obvious mucron at the end of terminus. Therefore, the main rice root nematode species found in Pathum Thani’s rice fields were H. mucronata. HIGHLIGHTS The rice root nematodes, Hirschmanniella, are presented the predominant plant-parasitic nematodes in rice cultivated areas of Pathum Thani province, Thailand Population densities of Hirschmanniella are encountered in rice roots than in soil, especially in RD47 rice cultivars grown in Muang District Both of morphological and molecular characterization illustrating the species of rice root nematodes were mucronate This is a first description on the molecular characterization of mucronata from rice fields in Thailand GRAPHICAL ABSTRACT

show abstract

Section: Resultssupporting

confidence: 92%

Section: Molecular Identificationmentioning

confidence: 99%

Incidence and Characterization of Rice Root Nematodes, Hirschmanniella mucronata, from Rice Fields in Pathum Thani Province, Thailand

et al. 2021

View full text Add to dashboard Cite

show abstract

“…Puddling could significantly reduce nematodes in PTR, while nematodes such as RKN, Meloidogyne triticoryzae, and Tylenchorhynchus mashoodi were higher in DSR (Gaur and Singh, 1993;Chandel et al, 2002). Similarly, Suong et al (2019) found higher root-parasitic nematodes in rice under direct-seeded mulch-based cropping system than in conventional plow-based tillage in Cambodia. The populations of Tylenchorhynchus brevilineatus and Pratylenchus spp were significantly higher in ZT than in CT fields (Pankaj et al, 2006).…”

Section: Introductionmentioning

confidence: 93%

Co-implementation of conservation tillage and herbicides reduces weed and nematode infestation and enhances the productivity of direct-seeded rice in North-western Indo-Gangetic Plains

Raj¹,

Das²,

Pankaj³

et al. 2022

Front. Sustain. Food Syst.

View full text Add to dashboard Cite

Direct-seeded rice (DSR) can be a resource-efficient alternative to puddled transplanted rice (PTR), but weeds and nematodes pose severe challenges. Conservation agriculture (CA)-based DSR may inhibit/influence weeds/nematodes, which can be further intensified by adopting better weed control. Hence, this experiment was undertaken. Five CA-based DSR practices involving zero tillage, residue retention, brown manuring, and superimposed with four weed control/herbicide options were compared with PTR in a split-plot design replicated three times. All DSRs encountered more weeds and plant parasitic nematodes (PPNs) than PTR. Root-knot nematodes (RKN) infested five among 14 weeds present in rice and was first time found in Dinebra retroflexa. A CA-based zero till (ZT)DSR+ mungbean residue – ZT wheat + rice residue – ZT mungbean+wheat residue system reduced weeds significantly. It reduced RKN galls in Echinochloa colona, Echinochloa crusgalli, and rice plants by 72, 58, and 56%, respectively. In soil too, RKN and other PPNs, namely, Tylenchorhynchus brevilineatus and Pratylenchus thornei were reduced by 39%, 32%, and 26%, respectively, which gave a 6.3–22.7% higher yield in this CA practice than other DSRs. Pyrazosulfuron-ethyl, cyhalofop-butyl, and bispyribac-Na applied sequentially reduced weeds and PPNs, increased rice yield by 176.1%, and were at below detectable levels in soil, rice grains, and straw, and were safe for rotational crops. The above ZT-based triple cropping with residue supplemented with herbicides through better weed and nematode control would be an alternative to PTR in the North-wester Indo-Gangetic Plains of India and in similar agroecologies of the tropics/sub-tropics. This study would help farmers and policymakers to design integrated weed and nematode management modules using tillage, crop residue, and herbicides/pesticides for higher DSR yield and income.

show abstract

“…Cambodian soils are seriously threatened by inappropriate agricultural systems. The returns on taking actions against land degradation are estimated at 3 US dollars for every dollar invested in restoring cropping systems on soil health, and SOC sequestration have been reported in several studies (Hok et al, 2015(Hok et al, , 2018(Hok et al, , 2021Pheap et al, 2019;Suong et al, 2019;Sar, 2021;Koun et al, 2023), however, the information on the impact of long-term NT systems on the changes in SOC stock remains scarce in the country as well as in Southeast Asia. There is a need to document the long-term changes in SOC stocks under CA and NT cropping systems to fill in the knowledge gaps as well as provide robust evidences to land use planners and policymakers.…”

Section: Introductionmentioning

confidence: 99%

Diachronic assessment of soil organic C and N dynamics under long-term no-till cropping systems in the tropical upland of Cambodia

Leng,

Cardinael,

Tivet

et al. 2024

Preprint

View full text Add to dashboard Cite

Abstract. No-till (NT) cropping systems have been proposed as a potential strategy to combat soil degradation and global warming by storing soil organic carbon (SOC) and nitrogen (N). Yet, there are ongoing debates about the real benefits of NT systems and factors influencing SOC and N accumulation. Assessing the dynamics of SOC and N on the long-term is needed to fill knowledge gaps and provide robust scientific evidence for potential additional SOC storage. We quantified the changes in SOC and N stocks and fractions down to 100 cm depth from three 13-year-old experiments in a tropical red Oxisol in Cambodia, comparing conventional tillage (CT) to NT monocropping and NT crop rotation systems using a diachronic and equivalent soil mass (ESM) approach. The three experiments comprised maize-, soybean-, and cassava-based cropping system trials, hereafter called MaiEx, SoyEx, and CasEx, respectively. Soil samples were collected in 2021, 10 years after the first sampling in 2011, at 7 depths: 0–5, 5–10, 10–20, 20–40, 40–60, 60–80, and 80–100 cm. Over the 10-year period (2011–2021), significant impacts on SOC stock and its vertical distribution differed among the NT systems and in the three experiments. In MaiEx and CasEx, the soils under all the NT systems significantly (P > 0.05) accumulated SOC stock across the soil depths, with the accumulation ranging from 6.97 to 14.71 Mg C ha-1 in the whole profile (0–100 cm). In SoyEx, significant increase in SOC stock was limited to the top 0–20 cm under NT monocropping, whereas NT crop rotation systems had significantly accumulating SOC stock from 0 to 80 cm depths. When considering 0–100 cm as a single stratum, the annual SOC cumulative rate in NT systems ranged from 0.86–1.47, 0.65–1.00, and 0.70–1.07 Mg C ha-1 yr-1 in MaiEx, SoyEx, and CasEx, respectively. In the top 0–10 cm, NT systems significantly increased C concentration in particulate organic matter (POM) by 115 %, 118 %, in MaiEx and SoyEx, respectively, and by 37 % in CasEx although not significantly. Similarly, at 0–10 cm depth, NT systems significantly enhanced C concentration in the mineral-associated organic matter (MAOM) by 33 %, 21 %, in MaiEx and SoyEx, respectively. Significant increase of C in MAOM was also observed from 0 to 40 cm in CasEx. In contrast, total N stock in NT systems increased in the surface 0–5 cm depth but decreased below 10 cm and in the whole profile (0–100 cm), particularly under NT monocropping with an annual loss rate of -0.10 and -0.17 Mg N ha-1 yr-1 in SoyEx and CasEx, respectively. Although NT systems increased N concentration in POM in the top 0–10 cm of MaiEx and SoyEx, a decreasing trend was observed below 10 cm depth. The N concentration in POM under NT systems in CasEx also decreased with soil depth. From 2011 to 2021, N concentration in MAOM under NT systems remained stable in MaiEx and SoyEx in the top 0–5 cm, but significant decreases in MaiEx and CasEx below 5 cm. Our findings suggest that adopting NT cropping systems with diverse crop and cover crop species and high biomass C inputs in the long-term leads to SOC accumulation not only in the surface but also in deeper layers, by increasing both the C pools in the POM and MAOM size fractions, even on the cassava-based system, which is believed to be an annual crop that could cause serious soil fertility depletion. This study highlights the potential of NT cropping systems to store SOC over time, but raises questions about soil N dynamics.

show abstract

Impact of a conservation agriculture system on soil characteristics, rice yield, and root-parasitic nematodes in a Cambodian lowland rice field

Cited by 10 publications

References 51 publications

Incidence and Characterization of Rice Root Nematodes, Hirschmanniella mucronata, from Rice Fields in Pathum Thani Province, Thailand

Incidence and Characterization of Rice Root Nematodes, Hirschmanniella mucronata, from Rice Fields in Pathum Thani Province, Thailand

Co-implementation of conservation tillage and herbicides reduces weed and nematode infestation and enhances the productivity of direct-seeded rice in North-western Indo-Gangetic Plains

Diachronic assessment of soil organic C and N dynamics under long-term no-till cropping systems in the tropical upland of Cambodia

Contact Info

Product

Resources

About