Immunomodulation by Mosquito Salivary Protein AgSAP Contributes to Early Host Infection by Plasmodium

Abstract

Malaria is a vector-borne disease caused by Plasmodium sporozoites. When an anopheline mosquito bites its host, it releases Plasmodium sporozoites as well as saliva components.

CD55 Facilitates Immune Evasion by Borrelia crocidurae, an Agent of Relapsing Fever

“…Spirochetes were incubated with either recombinant human or mouse CD55 or human PGLYRP1 conjugated with a His tag or with a control protein fused with a His tag at 50 μg/mL for 1 h at 4°C. After washing two times with PBS and incubating with an anti-His tag AF488-conjugated secondary antibody (1:50), the samples were incubated for an additional 30 min as described before ( 73 ). The spirochetes were washed with PBS and visualized by dark-field microscopy.…”

“…The primers used in the assay were Flab F, GAATTAATCGTGCATCTGAT , and Flab R, CATCCAAATTTCCTTCTGTTG . The mouse β-actin gene ( 30 , 73 ) was used to normalize the amount of DNA in each sample.…”

Two mosquito salivary antigens demonstrate promise as biomarkers of recent exposure toP. falciparuminfected mosquito bites

“…In a low transmission area, where infectious mosquito bites are less common, IgG responses to AgSAP peak after infectious mosquito exposure and decline by 3 months after infection. Since AgSAP is upregulated in infectious mosquitoes [21], a bite from an infectious mosquito could induce a greater serological response than a bite from an uninfected mosquito. AgSAP reactivity was highest among individuals with recent infection, suggesting that AgSAP serological responses peak 2-4 weeks after clinical malaria, which is itself at least 7-10 days after an infectious bite [36].…”

“…The first protein, AgSAP, is expressed in A. gambiae salivary glands and the midgut, and has increased expression in the salivary glands of mosquitoes infected with P. berghei [21]. AgSAP binds to both P. falciparum and P. berghei sporozoites, and though AgSAP does not affect sporozoite viability directly, AgSAP knockdown mosquitoes transmitted P. berghei less efficiently to mice whereas sporozoites incubated with AgSAP had higher P. berghei liver burden [21]. IgG antibodies to AgSAP are elicited by mosquito bites in mice, and additionally, mice immunized with AgSAP and exposed to infectious mosquito bites had a lower liver parasite burden [21].…”

“…AgSAP binds to both P. falciparum and P. berghei sporozoites, and though AgSAP does not affect sporozoite viability directly, AgSAP knockdown mosquitoes transmitted P. berghei less efficiently to mice whereas sporozoites incubated with AgSAP had higher P. berghei liver burden[21]. IgG antibodies to AgSAP are elicited by mosquito bites in mice, and additionally, mice immunized with AgSAP and exposed to infectious mosquito bites had a lower liver parasite burden[21]. In humans, people in a malaria-endemic area in Senegal had higher IgG reactivity to AgSAP than people in a non-endemic area[21].…”