Immunization with Neospora caninum profilin induces limited protection and a regulatory T-cell response in mice

Mansilla, Florencia Celeste; Quintana, María Eugenia; Langellotti, Cecilia; Wilda, Maximiliano; Martínez, A.; Fonzo, Adriana; Moore, D.P.; Cardoso, Nancy Patricia; Capozzo, Alejandra Victoria

doi:10.1016/j.exppara.2015.10.008

Cited by 16 publications

(17 citation statements)

References 40 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Cloning, expression and purification of rNcPRO have already been described . E. coli‐ expressed protein was obtained from inclusion bodies (IB‐rNcPRO) and purified by affinity chromatography following standard protocols.…”

Section: Methodsmentioning

confidence: 99%

“…The sequence encoding for NcPRO was previously cloned into a pCI‐Neo vector (Promega, Madison, WI, USA) and fused downstream the 212 amino acid of VSV‐G, which was already cloned in pCDNA3.1 (VSV‐G∆212 ). A new forward primer with NcoI restriction site (5′‐GTGACCATGGACTGGGATCCCGTTGTCAAG‐3′) and a reverse primer with an XbaI site (5′‐GCTCTAGATCACTAATAGCCAGACTGGTGAAGG‐3′) were designed.…”

Section: Methodsmentioning

confidence: 99%

“…A new forward primer with NcoI restriction site (5′‐GTGACCATGGACTGGGATCCCGTTGTCAAG‐3′) and a reverse primer with an XbaI site (5′‐GCTCTAGATCACTAATAGCCAGACTGGTGAAGG‐3′) were designed. The DNA template was pCI‐NcPRO . PCR was developed as follows: 4 minutes to 94°C, 35 cycles of 1 minutes at 94°C, 1 minutes to 50°C and 1 minutes to 72°C.…”

Section: Methodsmentioning

confidence: 99%

“…The recombinant protein was obtained by adding IPTG 1 mol/L to the culture of BL21plys. Inclusion bodies (IB‐rNcPRO/G) were purified following conventional protocols, and rNcPRO was purified by Ni 2+ affinity chromatography and used for vaccine formulations and in vitro assays.…”

Section: Methodsmentioning

confidence: 99%

“…Neospora caninum profilin (NcPRO), first characterized in 2010, is 89% homologous to TgPRO and can induce the production of IFN‐γ after injection in mice, both in vivo and in vitro . However, when we evaluated the efficacy of a vaccine based on a recombinant NcPRO (rNcPRO) in a mouse model, partial protection was observed, associated with the presence of antigen‐specific CD25 + /CD4 + /FoxP3 + T cells …”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Mansilla¹,

Quintana

Cardoso

et al. 2016

Parasite Immunology

View full text Add to dashboard Cite

We demonstrated recently that immunization with recombinant Neospora caninum profilin (rNcPRO) induces limited protection and a regulatory T-cell response in mice. The aim of this study was to evaluate the immune response elicited by rNcPRO in cattle and assess a strategy to enhance its immunogenicity, combining the addition of T-cell epitopes and immune modulators. We developed a chimeric recombinant profilin fused to functional T-cell epitopes present in the N-terminal sequence of vesicular stomatitis virus (VSV) glycoprotein G (rNcPRO/G). Groups of three cattle were immunized with two doses (2 weeks apart) of rNcPRO or rNcPRO/G formulated with alum hydroxide or a nanoparticulated soya-based adjuvant enriched with Toll-like receptor (TLR) 2 and TLR9 agonists, aimed to tackle the MyD88 pathway (AVECplus). rNcPRO induced only a primary immune response (IgM mediated), while antibodies in rNcPRO/G-vaccinated animals switched to IgG1 after the booster. The vaccine formulated with rNcPRO/G and AVECplus improved the production of systemic IFN-γ and induced long-term recall B-cell responses. Overall, our study provides data supporting the use of T-cell epitopes from VSV glycoprotein G and TLR agonists to enhance and modulate immunity to peptide antigens in bovines, particularly when using small proteins from parasites for which immune responses are usually feeble.

show abstract

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Mansilla¹,

Quintana

Cardoso

et al. 2016

Parasite Immunology

View full text Add to dashboard Cite

show abstract

Inhibition of JAK/STAT pathway restrains TSLP-activated dendritic cells mediated inflammatory T helper type 2 cell response in allergic rhinitis

et al. 2017

View full text Add to dashboard Cite

Thymic stromal lymphopoietin (TSLP) has recently been implicated as a key molecule for initiating allergic rhinitis (AR) at the cell-dendritic cell (DC) interface. Previous studies demonstrated that TSLP activated DCs to express more OX40 ligand (OX40L), which is associated with the initiation of T helper type 2 (Th2) cell responses. STAT phosphorylation has been reported to be promoted by TSLP. Thus, we investigated if the JAK/STAT pathway inhibitor CYT387 could affect TSLP-DC-mediated Th2 cell response in naive T cell and AR mice model. Western blot showed that the levels of phosphorylated JAK1, JAK2, STAT1, STAT3, and STAT5 were increased in TSLP-DCs, which can be offset by CYT387. Flow cytometry indicated that CYT387 had obviously down-regulated the surface maturation co-stimulatory molecules (CD11c, CD80, CD86, and MHCII) in DCs, which were increased by TSLP. Moreover, CYT387 markedly reduced the ability of TSLP-DCs to promote the differentiation of naive CD4 T cells into IL-4-expressing Th2 cells. The histological examination showed that the CYT387-treated group showed less epithelial disruption, epithelial cell proliferation, and reduced eosinophil infiltration compared with AR group. Western blot and RT-PCR demonstrated that the expression of OX40L was increased in AR mice, but that it was decreased by CYT387. Furthermore, CYT387 treatment resulted in the reduction of IL-4 and IL-5 expression and increased IFN-γ level in AR mice, which was consistent with the levels of intracellular cytokine in Th2 cell. In conclusion, we suggest that blockading the JAK/STAT pathway restrains inflammatory Th2 cell response induced by TSLP-DCs in AR.

show abstract

Working towards the development of vaccines and chemotherapeutics against neosporosis—With all of its ups and downs—Looking ahead

Imhof,

Hänggeli,

De Sousa

et al. 2024

Advances in Parasitology

View full text Add to dashboard Cite

Immunization with Neospora caninum profilin induces limited protection and a regulatory T-cell response in mice

Cited by 16 publications

References 40 publications

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Fusion of foreign T‐cell epitopes and addition of TLR agonists enhance immunity against Neospora caninum profilin in cattle

Inhibition of JAK/STAT pathway restrains TSLP-activated dendritic cells mediated inflammatory T helper type 2 cell response in allergic rhinitis

Working towards the development of vaccines and chemotherapeutics against neosporosis—With all of its ups and downs—Looking ahead

Contact Info

Product

Resources

About