Imaging and therapy of experimental schwannomas using HSV amplicon vector-encoding apoptotic protein under Schwann cell promoter

Abstract

Schwannomas are benign tumors forming along peripheral nerves that can cause deafness, pain and paralysis. Current treatment involves surgical resection, which can damage associated nerves. To achieve tumor regression without damage to nerve fibers, we generated an HSV amplicon vector in which the apoptosis-inducing enzyme, caspase-1 (ICE), was placed under the Schwann cell-specific P0 promoter. Infection of schwannoma, neuroblastoma and fibroblastic cells in culture with ICE under the P0 promoter showed selective toxicity to schwannoma cells, while ICE under a constitutive promoter was toxic to all cell types. After direct intratumoral injection of the P0-ICE amplicon vector, we achieved marked regression of schwannoma tumors in an experimental xenograft mouse model. Injection of this amplicon vector into the sciatic nerve produced no apparent injury to the associated dorsal root ganglia neurons or myelinated nerve fibers. The P0-ICE amplicon vector provides a potential means of 'knifeless resection' of schwannoma tumors by injection of the vector into the tumor with low risk of damage to associated nerve fibers.

Regression of Schwannomas Induced by Adeno-Associated Virus-Mediated Delivery of Caspase-1

“…Lim, House Ear Institute, Los Angeles, CA) was established from a schwannoma in a patient with NF2, immortalized with human papillomavirus E6/E7 genes (Hung et al, 2002) and maintained in Dulbecco's modified Eagle's medium (DMEM) with 2 lM forskolin (Calbiochem, San Diego, CA), recombinant glial growth factor (14 ng/ml; Sigma-Aldrich, St. Louis, MO), and G418 disulfate salt (50 lg/ml; Sigma-Aldrich). To obtain the HEI-193FC cell line, HEI-193 cells were infected with lentivirus encoding Fluc and mCherry (Prabhakar et al, 2010). Human neuroblastoma cell line SH-SY5Y (American Type Culture Collection [ATCC], Manassas, VA) was grown in DMEM-F12 (1:1) (GIBCO-BRL, Rockville, MD).…”

“…This plasmid carries two AAV2 inverted terminal repeat (ITR) elements, one wild type and one in which the terminal resolution site was deleted, as described (McCarty et al, 2003), generating a vector that is packaged as a double-stranded molecule. The dsAAV-P0-ICE plasmid was generated by replacing the CBA-GFP cassette in the parent plasmid with the PCR-amplified rat P0 promoter (1.1 kb; for full details of the P0 promoter see Brown and Lemke, 1997) and cDNA, using the plasmid HSV-P0-ICE (Prabhakar et al, 2010) as a template and the following primers: P0-1, AAAGGTAC Cacgagcattctcgaactctccaaa; P0-2, AAAACTAGTtctgcagaattcg atatcaagcttgg; mCaspase-1.1, aaaactagtgccaccatggctgtgagggc aaagaggaaG; mCaspase-1.2, AAAGCGGCCGCttaatgtcccggg aagaggtagAAA. The dsAAV-P0-GFP plasmid was generated by replacing the chicken b-actin (CBA) promoter in the parent plasmid with the PCR-amplified rat P0 promoter.…”

“…7, a similar implantation procedure was performed, differing only in that cells (60,000 in 1 ll) were implanted more proximally in the sciatic nerve. Tumor growth was monitored by in vivo bioluminescence imaging at weekly intervals, using the CMIR Image program (an image display and analysis suite developed in the Interactive Data Language [IDL; Research Systems/Exelis Visual Information Solutions, Boulder, CO]) as described (Prabhakar et al, 2010). Briefly, mice were injected intraperitoneally with the Fluc substrate d-luciferin, and, 5 min later, signal was acquired with a highefficiency IVIS Spectrum (Caliper Life Sciences, Hopkinton, MA) with an XGI-8 gas anesthesia system (Caliper Life Sciences) for Fig.…”

“…P0 promoter expression in Schwann cells is greater in young than in adult mice, with expression peaking at 1 month of age and decreasing to about 50% of peak by 2 months (Shen et al, 2011). Further, neurotoxicity would not be expected to occur because the P0 promoter is not expressed in neurons (Prabhakar et al, 2010).…”

“…Using this model, we demonstrated that intratumoral injection of a herpes simplex virus-1 (HSV-1) amplicon vector expressing caspase-1 (interleukin-b-converting enzyme; ICE) under the Schwann cell-specific P0 promoter led to tumor regression (Prabhakar et al, 2010). This gene therapy approach had two limitations; the subcutaneous location used was not clinically relevant and the HSV amplicon vector employed has never been used in clinical trials.…”