Illuminating Olea europaea L. endophyte fungal community

Costa, Daniela; Fernandes, Telma; Martins, Fátima; Pereira, José Alberto; Tavares, R. M.; Santos, Pedro M.; Baptista, Paula; Lino-Neto, Teresa

doi:10.1016/j.micres.2020.126693

Cited by 25 publications

(23 citation statements)

References 59 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The investigation will provide valuable references for other studies on microflora of soybean paste as well. (Costa et al, 2021;Delgado-Baquerizo et al, 2018;Muller et al, 2016). This may be due to the broad species diversity, adaptable capability, and faster evolutionary rate of the taxa (Wang et al, 2010).…”

Section: Discussionmentioning

confidence: 99%

“…The result was consistent with some previous studies of microbial diversity of fermented food, that is, soy sauce (Ma et al., 2019 ). Proteobacteria, Firmicutes, and Ascomycota were widespread; they are dominant microbial group in many other environmental systems such as plants and soils (Costa et al., 2021 ; Delgado‐Baquerizo et al., 2018 ; Muller et al., 2016 ). This may be due to the broad species diversity, adaptable capability, and faster evolutionary rate of the taxa (Wang et al., 2010 ).…”

Section: Discussionmentioning

confidence: 99%

“…The producing area or geographic location could influence plant and food quality and flavor properties through their distinctive soil, water, and sunshine, etc. (Costa et al., 2021 ; Huang et al., 2010 ). Microbial community and flavor had a certain relationship with geographical location (Ma et al., 2019 ).…”

Section: Discussionmentioning

confidence: 99%

“…The bacterial V3-V4 region of 16S rRNA gene was amplified with the primers 338F (ACTCCTACGGGAGGCAGCA) and 806R (GGACTACHVGGGTWTCTAAT) (Ren et al, 2020). ITS1F (CTTGGTCATTTAGAGGAAGTAA) and ITS2R (GCTGCGTTCTTCATC GATGC) were used to amplify fungal ITS1 region (Costa et al, 2021;White et al 1990). Mastercycler gradient (Eppendorf, Germany) was used for PCR performance.…”

Section: Dna Extraction Rdna Amplification and Sequencing Analysismentioning

confidence: 99%

See 3 more Smart Citations

Bacterial and fungal communities of traditional fermented Chinese soybean paste (Doujiang) and their properties

Ren

Yan

Liu

et al. 2021

Food Science & Nutrition

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Section: Dna Extraction Rdna Amplification and Sequencing Analysismentioning

confidence: 99%

See 2 more Smart Citations

Bacterial and fungal communities of traditional fermented Chinese soybean paste (Doujiang) and their properties

Ren

Yan

Liu

et al. 2021

Food Science & Nutrition

View full text Add to dashboard Cite

show abstract

“…In a study on 10 different olive genotypes, Müller et al [ 31 ] found that the structure of communities of endophytes thriving in olive leaves reconciled with the plant origins in “Eastern” and “Western” areas of the Mediterranean basin. Similarly, the analysis of the foliar fungal endophytes in different varieties revealed a strong signature driven by plant genotype [ 32 ]. In a wider study on 36 genotypes cultivated under a common garden setup, Fernández-González et al [ 28 ] found that plant genotype influenced the structure of root and rhizosphere bacterial and fungal communities.…”

Section: Introductionmentioning

confidence: 99%

Plant Genotype Shapes the Bacterial Microbiome of Fruits, Leaves, and Soil in Olive Plants

Malacrinò

Mosca

Nicosia

et al. 2022

Plants

View full text Add to dashboard Cite

The plant microbiome plays an important role in plant biology, ecology, and evolution. While recent technological developments enabled the characterization of plant-associated microbiota, we still know little about the impact of different biotic and abiotic factors on the diversity and structures of these microbial communities. Here, we characterized the structure of bacterial microbiomes of fruits, leaves, and soil collected from two olive genotypes (Sinopolese and Ottobratica), testing the hypothesis that plant genotype would impact each compartment with a different magnitude. Results show that plant genotype differently influenced the diversity, structure, composition, and co-occurence network at each compartment (fruits, leaves, soil), with a stronger effect on fruits compared to leaves and soil. Thus, plant genotype seems to be an important factor in shaping the structure of plant microbiomes in our system, and can be further explored to gain functional insights leading to improvements in plant productivity, nutrition, and defenses.

show abstract

Land use change rather than surrounding vegetation affects fungal endophyte assemblages in the African wild olive

Ngubane,

Dreyer,

Slippers

et al. 2023

Landsc Ecol

View full text Add to dashboard Cite

Context Land use change can significantly affect plant-fungal interactions. Objectives We assessed how fungal endophytes within African wild olive (Olea europaea subsp. cuspidata) twigs are influenced by different levels of land use change and differences in surrounding vegetation types. Methods Twigs were sampled in the Western Cape Province (South Africa) and their fungal endophyte assemblages were characterised using culture-independent DNA metabarcoding. We assessed the effects of land use change (natural, semi-natural and planted (completely transformed)) and differences in surrounding vegetation types (grasses/low-growing plants versus shrubs/trees versus other olives) using fungal endophyte alpha and beta diversity measures. Co-occurrence networks were constructed to assess assemblage connectivity under different scenarios and to identify OTUs of potential ecological significance. Results OTU richness, but not abundance, was significantly influenced by both land use change and differences in the surrounding vegetation types. Planted African olives and those surrounded by heterospecific trees harboured the highest OTU richness. Only levels of land use change significantly influenced fungal endophyte assemblage composition. Specifically, fungal assemblages from natural habitats were distinct from those in planted and semi-natural habitats, which were similar to each other. Co-occurrence network analyses revealed that cohesive and species rich networks could only be maintained within the natural habitats. Conclusion These findings suggest that although the African olive is widespread, the identity and composition of their associated fungal assemblages are particularly sensitive to land use change. This study highlights the importance of conserving natural habitats, not just for the plants, but also for the maintenance of their associated fungal endophytes.

show abstract

Illuminating Olea europaea L. endophyte fungal community

Cited by 25 publications

References 59 publications

Bacterial and fungal communities of traditional fermented Chinese soybean paste (Doujiang) and their properties

Bacterial and fungal communities of traditional fermented Chinese soybean paste (Doujiang) and their properties

Plant Genotype Shapes the Bacterial Microbiome of Fruits, Leaves, and Soil in Olive Plants

Land use change rather than surrounding vegetation affects fungal endophyte assemblages in the African wild olive

Contact Info

Product

Resources

About