IL2 Inducible T-cell Kinase, a Novel Therapeutic Target in Melanoma

Abstract

Purpose Interleukin-2 inducible T-cell kinase (ITK) promoter CpG sites are hypomethylated in melanomas compared to nevi. The expression of ITK in melanomas, however, has not been established and requires elucidation. Experimental Design An ITK specific monoclonal antibody was used to probe sections from de-identified, formalin-fixed paraffin-embedded tumor blocks or cell line arrays and ITK was visualized by immunohistochemistry. Levels of ITK protein differed among melanoma cell lines and representative lines were transduced with four different lentiviral constructs that each contained an shRNA designed to knockdown ITK mRNA levels. The effects of the selective ITK inhibitor BI 10N on cell lines and mouse models were also determined. Results ITK protein expression increased with nevus to metastatic melanoma progression. In melanoma cell lines, genetic or pharmacological inhibition of ITK decreased proliferation and migration and increased the percentage of cells in the G0/G1 phase. Treatment of melanoma-bearing mice with BI 10N reduced growth of ITK-expressing xenografts or established autochthonous (Tyr-Cre/Pten null/Braf V600E) melanomas. Conclusions We conclude that ITK, formerly considered an immune cell-specific protein, is aberrantly expressed in melanoma and promotes tumor development and progression. Our finding that ITK is aberrantly expressed in most metastatic melanomas suggests that inhibitors of ITK may be efficacious for melanoma treatment. The efficacy of a small molecule ITK inhibitor in the Tyr-Cre/Ptennull/BrafV600E mouse melanoma model supports this possibility.

ITK inhibition induced in vitro and in vivo anti-tumor activity through downregulating TCR signaling pathway in malignant T cell lymphoma

“…Lentiviral vectors containing green fluorescent protein (GFP) (shControl) or a short hairpin RNA (shRNA) sequence targeting ITK (shITK-34465: TCAGTACACCAGTTCCACAGG; shITK-34466: GCCTTATATGACTACCAAACC; shITK-34467: CTCCACACACGTCTACCAGAT) were obtained from GeneChem (Shanghai, China) [24]. Jurkat, H9, Hut-78 and Karpas-299 cells were infected with shControl or shITK at a multiplicity of infection (MOI) of 1: 50, and cultured for 72 h for use in subsequent experiments.…”

Targeting SLP76:ITK interaction separates GVHD from GVL in allo-HSCT

“…Since T cells from SLP76Y145FKI mice can separate GVHD from GVL, we sought to determine whether disruption of ITK signaling with pharmacological agents would have a similar effect. When we used several commercially available small molecule inhibitors, including 10n ( Carson et al., 2015 ; Riether et al., 2009 ), CTA056 ( Guo et al., 2012 ), and GSK2250665A ( Alder et al., 2013 ), we observed that these small molecules also inhibit several other kinases including mTOR and AKT, suggesting that these molecules were not specific ( Figures S7 A–S7F). Thus, we sought to design a novel inhibitor that would explicitly target the SLP76-ITK interaction and signaling by preventing the SH2 domain of ITK from docking onto SLP76 at tyrosine 145.…”

A Network-centric Framework for the Evaluation of Mutual Exclusivity Tests on Cancer Drivers

“…RAC1 is found to be mutually exclusive with MYH9, a tumor suppressor in melanoma [Singh et al, 2020]. Lastly, ITK has been shown to be an oncogene in melanoma [Carson et al, 2015]. For UCEC, we identify 33 genes in total.…”