IFNL4-ΔG Genotype Is Associated With Slower Viral Clearance in Hepatitis C, Genotype-1 Patients Treated With Sofosbuvir and Ribavirin

Meissner, Eric G.; Bon, Dimitra; Prokunina‐Olsson, Ludmila; Tang, Wei; Masur, Henry; O’Brien, Thomas R.; Herrmann, Eva; Kottilil, Shyamasundaran; Osinusi, A.

doi:10.1093/infdis/jit827

Cited by 80 publications

(78 citation statements)

References 15 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…However, there are several clinical as well as scientific reasons to pursue a deeper understanding of how IFNL genotype impact viral clearance. Several recent studies show that rs368234815 influences the response kinetics to DAA 28,30 ; however, the role of rs117648444 in DAA treatment has not yet been investigated. This suggests that patients not expressing IFNl4 can receive a shortened DAA treatment and possibly also reduced doses.…”

Section: Discussionmentioning

confidence: 99%

Reduced IFNλ4 activity is associated with improved HCV clearance and reduced expression of interferon-stimulated genes

et al. 2014

View full text Add to dashboard Cite

Hepatitis C virus (HCV) infections are the major cause of chronic liver disease, cirrhosis and hepatocellular carcinoma worldwide. Both spontaneous and treatment-induced clearance of HCV depend on genetic variation within the interferon-lambda locus, but until now no clear causal relationship has been established. Here we demonstrate that an amino-acid substitution in the IFNl4 protein changing a proline at position 70 to a serine (P70S) substantially alters its antiviral activity. Patients harbouring the impaired IFNl4-S70 variant display lower interferon-stimulated gene (ISG) expression levels, better treatment response rates and better spontaneous clearance rates, compared with patients coding for the fully active IFNl4-P70 variant. Altogether, these data provide evidence supporting a role for the active IFNl4 protein as the driver of high hepatic ISG expression as well as the cause of poor HCV clearance.

show abstract

Section: Discussionmentioning

confidence: 99%

Reduced IFNλ4 activity is associated with improved HCV clearance and reduced expression of interferon-stimulated genes

et al. 2014

View full text Add to dashboard Cite

show abstract

“…Relative expression of IFNs or their receptors in EOT liver biopsies did not differ by treatment outcome (Figure 8, A-D), although this analysis was limited by the absence of pretreatment liver biopsies, precluding assessment of longitudinal changes. We genotyped all samples (n = 33) for 3 genetic variants associated with HCV clearance: the intronic rs12979860-C/T (29,30) and exonic rs368234815-TT/ΔG (31,32) of IFNL4 and the 3′ untranslated region (UTR) rs4803217-T/G of IFNL3 (Supplemental Tables 1 and 5 and ref. 33).…”

Section: Resultsmentioning

confidence: 99%

“…Genotyping of IFNL4 variants rs12979860-T/C and rs368234815-TT/ΔG (originally designated as ss469415590) was performed using genomic DNA samples and custom-designed TaqMan assays as previously described (31,32). rs4803217-T/G was genotyped with a custom-designed TaqMan assay: forward primer, CTGTGTGTCT-GACCCTTCCG; reverse primer, TCCTGGAGGTGAGTTGGATT-TAC; probe for allele T, CAATAAATTAAGACAAGTGGCTA (VIC, MGB); probe for allele G, ATAAATTAAGCCAAGTGGCTA (FAM, MGB).…”

Section: Genotypingmentioning

confidence: 99%

Endogenous intrahepatic IFNs and association with IFN-free HCV treatment outcome

Meissner¹,

Wu²,

Osinusi³

et al. 2014

J. Clin. Invest.

Self Cite

188

192

View full text Add to dashboard Cite

BACKGROUND. Hepatitis C virus (HCV) infects approximately 170 million people worldwide and may lead to cirrhosis and hepatocellular carcinoma in chronically infected individuals. Treatment is rapidly evolving from IFN-α-based therapies to IFN-α-free regimens that consist of directly acting antiviral agents (DAAs), which demonstrate improved efficacy and tolerability in clinical trials. Virologic relapse after DAA therapy is a common cause of treatment failure; however, it is not clear why relapse occurs or whether certain individuals are more prone to recurrent viremia. METHODS.We conducted a clinical trial using the DAA sofosbuvir plus ribavirin (SOF/RBV) and performed detailed mRNA expression analysis in liver and peripheral blood from patients who achieved either a sustained virologic response (SVR) or relapsed. RESULTS.On-treatment viral clearance was accompanied by rapid downregulation of IFN-stimulated genes (ISGs) in liver and blood, regardless of treatment outcome. Analysis of paired pretreatment and end of treatment (EOT) liver biopsies from SVR patients showed that viral clearance was accompanied by decreased expression of type II and III IFNs, but unexpectedly increased expression of the type I IFN IFNA2. mRNA expression of ISGs was higher in EOT liver biopsies of patients who achieved SVR than in patients who later relapsed. CONCLUSION.These results suggest that restoration of type I intrahepatic IFN signaling by EOT may facilitate HCV eradication and prevention of relapse upon withdrawal of SOF/RBV. TRIAL REGISTRATION. ClinicalTrials.gov NCT01441180. FUNDING. Intramural Programs of the National Institute of Allergy and Infectious The Journal of Clinical Investigation C l i n i C a l M e d i C i n e3 3 5 3 jci.orgVolume 124 Number 8 August 2014We next evaluated on-treatment serum protein levels of select chemokines and cytokines and observed similar expression at baseline and during treatment comparing patients who achieved SVR versus those who relapsed (Supplemental Table 3). Serum levels of the IFN-inducible cytokine IP-10, the protein product of the CXCL10 gene that was downregulated in liver (Figure 2A), correlated significantly with baseline viral load ( Figure 3A). Expression decreased rapidly on-treatment, regardless of treatment outcome, and increased with relapse ( Figure 3B). Viral kinetic and IP-10 decline were significantly correlated ( Figure 3C and Table 1). IL-10 and IFN-γ decreased modestly during treatment, while expression of most other proteins did not change, including TGF-β1 and TIMP1, which are associated with hepatic fibrosis (Supplemental Table 3 and ref. 25).To assess whether a similar pattern of gene expression changes could be observed in the periphery, we performed microarray mRNA analysis in PBMCs collected before treatment, early in treatment (day 6-11), and at EOT (week 24) and identified a significant decrease of IFN signaling during treatment (Supplemental Figure 2 and Supplemental Table 4). qRT-PCR analysis in PBMCs confirmed rapid and sustained downregulation of I...

show abstract

“…Recent studies have reported the dependence of viral kinetics on SNPs even in IFN-free treatment regimens 59,60 and recent trials with some two-DAA combinations without PR have been stunningly successful with 490% SVR in previous null responders to PR 61 . We speculate that this success may arise from a combination of three modes of DAA action.…”

Section: Discussionmentioning

confidence: 99%

Emergent properties of the interferon-signalling network may underlie the success of hepatitis C treatment

2014

View full text Add to dashboard Cite

Current interferon alpha-based treatment of hepatitis C virus (HCV) infection fails to cure a sizeable fraction of patients treated. The cause of this treatment failure remains unknown. Here using mathematical modelling, we predict treatment failure to be a consequence of the emergent properties of the interferon-signalling network. HCV induces bistability in the network, creating a new steady state where it can persist. Cells that admit the new steady state alone are refractory to interferon. Using a model of viral kinetics, we show that when the fraction of cells refractory to interferon in a patient exceeds a critical value, treatment fails. Direct-acting antivirals that suppress HCV replication can eliminate the new steady state, restoring interferon sensitivity and improving treatment response. Our study thus presents a new conceptual basis of HCV persistence and treatment response, elucidates the origin of the synergy between interferon and direct-acting antivirals, and facilitates rational treatment optimization.

show abstract

IFNL4-ΔG Genotype Is Associated With Slower Viral Clearance in Hepatitis C, Genotype-1 Patients Treated With Sofosbuvir and Ribavirin

Cited by 80 publications

References 15 publications

Reduced IFNλ4 activity is associated with improved HCV clearance and reduced expression of interferon-stimulated genes

Reduced IFNλ4 activity is associated with improved HCV clearance and reduced expression of interferon-stimulated genes

Endogenous intrahepatic IFNs and association with IFN-free HCV treatment outcome

Emergent properties of the interferon-signalling network may underlie the success of hepatitis C treatment

Contact Info

Product

Resources

About