Identification of two new DPB1 alleles, DPB1*7701 and *7801, by sequence‐based typing

Voorter, C. E. M.; Richeldi, Luca; Gervais, T.; Berg-Loonen, E. van den

doi:10.1111/j.1399-0039.1998.tb02285.x

Cited by 11 publications

(7 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Amplification of exon 2 of the HLA‐G gene (356 bp) was performed as reported previously 23. Amplification of exon 2 of the HLA‐DPB1 gene (432 bp) was carried out as described earlier using generic primers (5′‐GAGAGTGGCGCCTCCGCTC‐3′, 5′‐TGAATCCCCAACCCAAAGTCCCC‐3′) 24…”

Section: Methodsmentioning

confidence: 99%

Genetic alterations of HLA‐class II in ovarian cancer

Kübler

Arndt

Wardelmann

et al. 2008

Intl Journal of Cancer

View full text Add to dashboard Cite

The immune system controls tumor formation through identification and elimination of cellular alterations. Consequently, cancer development in immune competent hosts depends on strategies to evade the immune system. Modulation of tumor antigen-specific immune responses by aberrant expression of HLA-class I and II molecules is well documented in a variety of carcinomas including ovarian cancer. To date, little data are available about molecular mechanisms responsible for altered HLA-class II phenotypes in tumors. In our sample of 10 Caucasian patients with ovarian carcinoma, a semiquantitative analysis was performed for HLA-class II loci DRB1 and DQB1 in malignant and normal ovarian tissue. Gene amplifications were identified in 62.5% of analyzed alleles and deletions in 17.5%, demonstrating that genomic aberrations of 6p21.3 are common and that copy number gain is more frequent than loss. Moreover, amplifications are most pronounced in advanced-stage tumors. To evaluate genotype-phenotype relation, immunohistochemical analyses were performed and revealed de novo expression of HLA-class II in 30% of tumors with an inverse association between antigen level and HLA copy number. It remains to be elucidated whether the profound changes of the latter quantities are the result of the host's immunological selfdefense, indicate the presence of an oncogene located within the MHC-complex or merely reflect the increasing loss of differentiation of the tumor tissue.

show abstract

Section: Methodsmentioning

confidence: 99%

Genetic alterations of HLA‐class II in ovarian cancer

Kübler

Arndt

Wardelmann

et al. 2008

Intl Journal of Cancer

View full text Add to dashboard Cite

show abstract

“…Depending on the allele groups that were identified, high-resolution typing was performed by a subsequent PCR-SSP using additional primer mixes, or by sequence-based typing [11,12]. For high-resolution typing of HLA-DPB1, sequencebased typing was used in all instances [13]. Highresolution typing for DRB1/3/4/5, DQB1 and DPB1 was performed for all individuals studied, except in nine cases where high resolution of DRB3/4/5 and/or DQB1 was not possible due to a shortage of material.…”

Section: Tumour Necrosis Factor-a Gene Polymorphism Analysismentioning

confidence: 99%

“…The sequence-based typing method for the HLA class II alleles was carried out as described previously [11][12][13]. For SBT of all class II genes, a PCR product was generated by amplification of exon 2 and, if needed, exon 3 using amplification and sequencing primers located at the 59 and 39 end of exon 2 or in introns 1 and 2.…”

Section: Tumour Necrosis Factor-a Gene Polymorphism Analysismentioning

confidence: 99%

Major histocompatibility locus genetic markers of beryllium sensitization and disease

et al. 2001

Self Cite

View full text Add to dashboard Cite

Hypersensitivity to beryllium (Be) is found in 1–16% of exposed workers undergoing immunological screening for beryllium disease using the beryllium lymphocyte proliferation test (BeLPT). However, only ∼50% of BeLPT-positive workers present with lung granulomas (i.e.berylliosis). As berylliosis is associated with the human leukocyte antigen (HLA)-DP supratypic marker DPGlu69, the authors asked whether this marker is differentially associated with disease presentation.A population of 639 workers from a beryllium factory undergoing BeLPT screening was evaluated in a nested case-control study for the prevalence of HLA-DPGlu69, the HLA-DPB1, HLA-DQ and HLA-DR alleles and of the biallelic tumour necrosis factor (TNF)-;α polymorphism TNF-;α-;308 in 23 individuals presenting as “sensitized” (i.e.BeLPT-positive without lung granulomas) and in 22 presenting as “diseased” (i.e.BeLPT-positive with granulomas in the lung biopsy).The HLA-DPGlu69 marker was associated with “disease” (odds ratio (OR) 3.7, p=0.016, 95% confidence interval (CI) 1.4–10.0), whilst the high TNF-;α production-related TNF-;α-;308*2 marker was associated with both a positive BeLPT (OR 7.8, corrected p<0.0001, 95% CI 3.2–19.1) with no difference between “sensitization” and “disease”. Furthermore, the HLA-DRArg74 marker was associated with “sensitization” without disease (OR 3.96, p=0.005, 95% CI 1.5–10.1).The data indicate that tumour necrosis factor-;α, human leukocyte antigen-DR and human leukocyte antigen-DP markers play different roles in beryllium sensitization and granuloma formation in beryllium-exposed workers.

show abstract

“…For SBT of DPB1, amplification of exon 2 was performed using generic primers located in introns 1 and 2 (95025, 95026) as previously described ( 4, 5). The heterozygous PCR product was sequenced using the solid phase sequencing approach as described ( 5, 6). For forward and reversed sequencing, the previously described primers 95033 and 95034 ( 5) were used respectively.…”

Section: Sequence and Location Of Allele‐specific Primers For Sbt Of mentioning

confidence: 99%

“…The heterozygous PCR product was sequenced using the solid phase sequencing approach as described ( 5, 6). For forward and reversed sequencing, the previously described primers 95033 and 95034 ( 5) were used respectively. After evaluation of the sequence data, subtype assignment was performed with the Sequityper software (Pharmacia, Uppsala, Sweden).…”

Section: Sequence and Location Of Allele‐specific Primers For Sbt Of mentioning

confidence: 99%

Two new HLA DPB1 alleles identified by sequence‐based typing: DPB18201 and DPB18301

Voorter

Tilanus²,

Berg‐Loonen

2000

Tissue Antigens

View full text Add to dashboard Cite

show abstract

Identification of two new DPB1 alleles, DPB17701 and 7801, by sequence‐based typing

Cited by 11 publications

References 8 publications

Genetic alterations of HLA‐class II in ovarian cancer

Genetic alterations of HLA‐class II in ovarian cancer

Major histocompatibility locus genetic markers of beryllium sensitization and disease

Two new HLA DPB1 alleles identified by sequence‐based typing: DPB18201 and DPB18301

Contact Info

Product

Resources

About

Identification of two new DPB1 alleles, DPB1*7701 and *7801, by sequence‐based typing

Cited by 11 publications

References 8 publications

Genetic alterations of HLA‐class II in ovarian cancer

Genetic alterations of HLA‐class II in ovarian cancer

Major histocompatibility locus genetic markers of beryllium sensitization and disease

Two new HLA DPB1 alleles identified by sequence‐based typing: DPB1*8201 and DPB1*8301

Contact Info

Product

Resources

About

Identification of two new DPB1 alleles, DPB17701 and 7801, by sequence‐based typing

Two new HLA DPB1 alleles identified by sequence‐based typing: DPB18201 and DPB18301