Identification of the NovelNup188-brr7Allele in a Screen for Cold-Sensitive mRNA Export Mutants inSaccharomyces cerevisiae

Abstract

The maturation and export of mRNA from the nucleus through the nuclear pore complex is critical for maintaining an appropriate proteome in all eukaryotic cells. Here we summarize a previously unpublished screen in S. cerevisiae that utilized an established dT50 in situ hybridization assay to identify cold-sensitive mutants that accumulated bulk poly A RNA in the nucleus. The screen identified seven mutants in six complementation groups, including the brr6-1 strain that we described previously. In addition to brr6-1, we identified novel alleles of the key transport gene GLE1 and NUP188, a component of the Nic96 nucleoporin complex. Notably, we show that the nup188-brr7 allele causes defects in select protein import pathways as well as mRNA export. Given recent structural and functional evidence linking the Nic96 complex to transport components, this mutant may be particularly useful to the transport community.

Bi-allelic Loss-of-Function Variants in NUP188 Cause a Recognizable Syndrome Characterized by Neurologic, Ocular, and Cardiac Abnormalities

“…This result is congruent with the finding that loss of NUP188 results in a reduction of nuclear import and mRNA export in yeast. 11 In human cells and in yeast, loss of NUP188 did not result in total absence of nuclear import. However, because nuclear transport is integral to the central cell processes of DNA replication, gene expression, and protein production, even a modest reduction in transport capacity could have a major impact on cell homeostasis.…”

“…Nuclear import was assayed with a protocol adapted from yeast. 11 A lentiviral vector containing three GFP molecules attached to the SV40 nuclear localization signal (NLS) (pHAGE-EFS-PCP-3XGFPnls) was obtained as gift from Thoru Pederson (Addgene plasmid #75385). 19 To generate GFP constructs with no NLSs and to generate the hnRNPA1 NLS, double-stranded DNA oligos (5 0 -5Phos/GCCGCCGCCTAA-3 0 and 5 0 -5Phos/TCAAATTTTGGAC CCATGAAGGGAGGAAATTTTGGAGGCAGAAGCTCTGGCCCCT ATTAA-3 0 , respectively) were cloned into pHAGE-EFS-PCP-3XGFPnls between the XhoI and XbaI sites.…”

“…Loss of NUP188 results in a reduction of nuclear import in yeast. 11 To determine whether nuclear import is also disrupted in affected individuals, we infected fibroblasts from individuals 1 and 2 and unrelated control individuals with a construct that encodes three sequential GFP molecules attached to an NLS and measured GFP fluorescence intensity in the cytoplasm and nucleus of infected cells. To test both the ''classic'' importina-importinb1 nuclear import pathway and the transportin-1 pathway, we created constructs containing the SV40 NLS and hnRNPA1 NLS, respectively.…”

“…1 Disruption of NUP188 in yeast has been shown to inhibit both mRNA export and protein trafficking through the NPC. 11 NUP188 has also been implicated in a diverse range of cellular functions outside of its role in nuclear transport; such functions include ciliogenesis, 12 chromatin organization, 13 transcriptional regulation, 13 and chromosome segregation. 14 A rare NUP188 duplication was reported in an individual with heterotaxy, and knockdown of Nup188 disrupted left-right patterning in Xenopus.…”

A Boy with Sandestig-Stefanova Syndrome and Genital Abnormalities

“…The authors speculate that although their study assumes that the reduction in nuclear transport is at least partially responsible for the phenotype of the affected individuals, the possibility that disruption of one or more of the other functions of NUP188 may also contribute to disease progression [Muir et al, 2020]. Loss of NUP188 results in a reduction of nuclear import and mRNA export in yeast [de Bruyn Kops and Guthrie, 2018].…”