Identification of the etiological agent of equine piroplasmosis in Western and Eastern Siberia

Рар, В. А.; Марченко, В. А.; Efremova, E. A.; Suntsova, O. V.; Лисак, О. В.; Tikunov, Artem; Мельцов, И. В.; Tikunova, Nina

doi:10.18699/vj18.351

Cited by 6 publications

(6 citation statements)

References 9 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Суммарные нуклеиновые кислоты экстрагировали из образцов с помощью набора «Рибо-преп» («Амплипрайм», Москва). Выделенные образцы ДНК были исследованы методом гнез довой двухраундовой ПЦР с использованием праймеров из области гена 18S рРНК для детекции бабезий и тейлерий, и праймеров из области гена 16S рРНК для выявления ДНК анаплазм, как описано ранее [4,5]. Образцы, содержащие ДНК пироплазм, были исследованы на наличие B. caballi и T. equi при проведении второго раунда ПЦР в присутствии видоспецифичных праймеров Bcab-F (gatggcgacttaaaccctcg)/Bcab-R (aaaagggaagctagttagcag) и Teq-F (gggaatttaaaccccttccag)/Teq-R (tccttgcgatttatgaccgc), соответственно.…”

Section: материалы и методыunclassified

Epizootic Situation of Hemoparasitic Diseases of Farm Animals in Irkutsk Region

Suntsova,

Rar,

Lisak

et al. 2023

SJLSA

View full text Add to dashboard Cite

Background. Cattle anaplasmosis and babesiosis and theileriosis of horses are a group of natural focal vector-borne diseases that cause significant economic damage to livestock and horse breeding around the world. On the territory of the Baikal region these diseases and their pathogens remain little explored. Purpose – to study the epizootic situation of blood-parasitic diseases of farm animals in the Irkutsk region, to establish the species affiliation of the identified pathogens and their genetic diversity. Materials and methods. For the presence of Babesia spp./Theileria spp. and Anaplasma spp. has been researched659 horse blood samples, 579 sheep blood samples, 25 goat blood samples and 647 cattle blood samples. For the detection of babesia and theileria, nested two-round PCR with primers from the 18S rRNA gene region was used, and for the detection of anaplasma DNA with primers from the 16S rRNA gene region. For study the genetic diversity of the identified pathogens, selective sequencing of samples was carried out with subsequent phylogenetic analysis. Results. The DNA of Anaplasma spp. was detected in blood samples of small ruminants from 12 districts of the region. The infection rate of sheep and goats was 68.7±1.9% and 68%±9.3%, respectively. Nucleotide sequences of the 16S rRNA gene fragment were determined in 68 A. ovis samples from the blood of sheep and goats. The researched sequences were conservative for the studied gene and differed from each other in two heterozygous sites of the gene(T/C and G/A nucleotide substitutions).They corresponded to the sequences of the prototype strain Haibei (CP015994), as well as to the A. ovis sequences previously found in the blood of sheep from Altai (Russia) and Mongolia, deer and D. niveus and D. nuttalli ticks from China. DNA of Babesia spp./Theileria spp. found in blood samples of horses from 13 districts of the region. The average infection of horses was 64.2%±1.9%. Two etiological agents of equine piroplasmosis were found in the blood of the examined horses: T. equi (genetic groups A and E) and B. caballi. Definite sequences of the B. caballi 18S rRNA gene (700–1146 bp) were identical to each other and differed by at least ten substitutions and one deletion from the sequences available in the GenBank database. However, the greatest similarity was observed with B. caballi sequences found in the blood of a horse from Brazil (KY952238), ticks from Kazakhstan (MN907451) and China (MN173021). The results indicate that DNA of Anaplasma and Babesia in the blood of cattle have not been identified. Conclusion: The data received evidence a wide distribution of foci of small cattle anaplasmosis and piroplasmosis of horses in the Irkutsk region and the need to continue monitoring their epizootic condition.

show abstract

Section: материалы и методыunclassified

Epizootic Situation of Hemoparasitic Diseases of Farm Animals in Irkutsk Region

Suntsova,

Rar,

Lisak

et al. 2023

SJLSA

View full text Add to dashboard Cite

show abstract

“…gov/BLAST). Постановку ПЦР осуществляли в Институте химической биологии и фундаментальной медицины СО РАН по методике, описанной ранее [4].…”

Section: материалы и методыunclassified

“…В антропогенной среде (места обитания животных) постоянно функционируют очаги пироплазмидозов и периодически происходят вспышки кровепаразитарных заболеваний у лошадей в Сибири, однако они не привлекают должного внимания исследователей. В научной литературе имеются лишь фрагментарные сведения об этих инвазиях, основанных в основном на клинических признаках заболевания и в немногих исследованиях, проведенных с использованием генетических методов, был идентифицирован только один возбудитель пироплазмидоза -T. equi [3,4], в то же время B. caballi ранее широко выявляли во многих неблагополучных по пироплазмозу регионах, в том числе и на Алтае [5].…”

Section: Introductionunclassified

Prophylactic efficacy of drugs against equine piroplasmidosis in Gorny Altai

Марченко

Рар

Biryukov

2022

Ross. parazitol. ž..

Self Cite

View full text Add to dashboard Cite

The purpose of the research is to study the prophylactic efficacy of piroplasmicides and to elucidate the effect of prophylactic doses of Imidocarb Dipropionate on the pathogen viability.Materials and methods. Babezan 12% was intramuscularly injected to 150 horses based on the active substance of Imidocarb Dipropionate at 2.5 mg/kg of the body weight and Neosidin M was injected to 30 horses twice at a dose of 2.5 mL per 100 kg of the live weight with a 15-day interval. The control group of animals did not receive the drug. The clinical follow-up of the experimental and control animals’ condition was done for 72 days. Before the experiment and 14 days after the drugs, blood samples were examined by the nested PCR in the presence of genus-specific primers from the 18S rRNA gene sequence for the Babesia spp. / Theileria spp. DNA. Species identification and genotyping of the detected Piroplasma were performed by sequencing 18S rRNA gene fragments.Results and discussion. Among 12 examined horses, 8 animals (66.7%) had the Piroplasmida DNA found in the blood samples, of which 50.0% were identified as Theileria equi and 16.7% as Babesia caballi. A high T. equi DNA prevalence (over 50.0%) indicates an endemic course of equine theileriosis. Babesan 12% in early chemotherapy of the horses helped to prevent the incidence of theileriosis within 48 and 59 days. Double chemotherapy of the horses with Neosidin M with a 15-day interval prevented the morbidity for 52 days. Babesan 12% at the preventive dose had no effect on the viability of persistent T. equi stages.

show abstract

“…Видовая принадлежность 1 Федеральное государственное бюджетное научное учреждение «Федеральный Алтайский научный центр агробиотехнологий» (656910, г. Барнаул, Научный городок, д. 35) 2 Федеральное государственное бюджетное учреждение науки Институт химической биологии и фундаментальной медицины Сибирского отделения Российской академии наук (630090, г. Новосибирск, пр. Лаврентьева, д.…”

unclassified

“…Имеются лишь фрагментарные данные о случаях данного заболевания, при этом диагноз в большинстве случаев основан только на клинической картине. В немногих исследованиях, проведенных с использованием генетических методов, был идентифицирован только один возбудитель пироплазмидоза -T. equi[1,2]. Следует отметить, что B. caballi Актуальные проблемы сельского хозяйства горных территорий: материалы V междунар.…”

unclassified

Prevention of Pyroplasmidoses of Horses in Gorny Altai

Marchenko¹,

Rar²,

Aybykova³

2021

Theory and Practice of Parasitic Disease Control

View full text Add to dashboard Cite

A high incidence of pyroplasmidoses (hemosporidial infections) of horses in the farms of Gorny Altai presupposes regular preventive measures against this disease. The main preventive measure is early specific chemotherapy of horses in spring. In this connection, we carried out a study on the species identification of the pathogen and the assessment of prophylactic efficacy of an antipyroplasmid drug. The studies were carried out in the livestock farm Kurmanov Ch.A. in the Ulagansky District of the Altai Republic. The blood samples from 20 horses were tested by nested polymerase chain reaction (nested PCR) in the presence of genus-specific primers for DNA of the protozoan blood parasites Babesia spp. and Theileria spp. The species membership of the identified infectious agents was established by determining nucleotide sequences of the PCR products. When studying prophylactic efficacy, "Babezan, 12%" was administered intramuscularly to the experimental group of horses (44 animals) at the rate of 2.5 mg of active substance per 1 kg of animal weight; the control group of horses (16 animals) was not given the drug. The blood samples examined were found to contain the DNA of Theileria spp. in 17 animals (85%), which was identified as Theileria equi. Early chemotherapy of the horses with "Babezan, 12%" based on the active substance imidocarb dipropionate at 2.5 mg per 1 kg of animal weight made it possible to prevent morbidity for 41 days.

show abstract

Identification of the etiological agent of equine piroplasmosis in Western and Eastern Siberia

Cited by 6 publications

References 9 publications

Epizootic Situation of Hemoparasitic Diseases of Farm Animals in Irkutsk Region

Epizootic Situation of Hemoparasitic Diseases of Farm Animals in Irkutsk Region

Prophylactic efficacy of drugs against equine piroplasmidosis in Gorny Altai

Prevention of Pyroplasmidoses of Horses in Gorny Altai

Contact Info

Product

Resources

About