Identification of ten novel SLC5A2 mutations and determination of the renal threshold for glucose excretion in Chinese patients with familial renal glucosuria

Wang, Qianqian; Zhao, Xiangzhong; Zhang, Ruixiao; Wang, Cui; Han, Yue; Shao, Leping

doi:10.1016/j.cca.2018.12.024

Cited by 9 publications

(11 citation statements)

References 17 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…All SLC5A2 missense variants were selected from the Human Gene Mutation Database (March 2019) and literature (Dhayat et al, 2016;Yu et al, 2016a,b;Gong et al, 2017;Wang et al, 2017) His525Tyrand c.1739G > A p.(Gly580Asp), which were identified in our patients (Zhao et al, 2016;Wang et al, 2019). These variants were analyzed through online bioinformatics software to determine their possible effects on pre-mRNA processing.…”

Section: In Silico Prediction and Screening Criteriamentioning

confidence: 99%

“…Familial renal glucosuria (FRG) is a rare renal tubular disease, which is characterized by persistent glucosuria without aberrant glucose metabolism and any other symptoms of tubular malfunction (Calado et al, 2008;Aires et al, 2015;Wang et al, 2019). The vast majority of FRG patients are associated with SLC5A2 (OMIM 182381) pathogenic variants (Calado et al, 2008;Sada et al, 2019;Wang et al, 2019). The full-length SLC5A2 gene is 7.7 kb located on chromosome 16p11.2 and encodes for a 672 amino acid low-affinity sodium/glucose co-transporter 2 (SGLT2) with a total of 14 exons (Wells et al, 1993).…”

Section: Introductionmentioning

confidence: 99%

See 1 more Smart Citation

Six Exonic Variants in the SLC5A2 Gene Cause Exon Skipping in a Minigene Assay

Wang

Liu

et al. 2020

Front. Genet.

Self Cite

View full text Add to dashboard Cite

Background: Familial renal glucosuria is a rare renal tubular disorder caused by SLC5A2 gene variants. Most of them are exonic variants and have been classified as missense variants. However, there is growing evidence that some of these variants can be detrimental by affecting the pre-mRNA splicing process. Therefore, we hypothesize that a certain proportion of SLC5A2 exonic variants can result in disease via interfering with the normal splicing process of the pre-mRNA. Methods: We used bioinformatics programs to analyze 77 previously described presumed SLC5A2 missense variants and identified candidate variants that may alter the splicing of pre-mRNA through minigene assays. Results: Our study indicated six of 7 candidate variants induced splicing alterations. Variants c.216C > A, c.294C > A, c.886G > C, c.932A > G and c.962A > G may disrupt splicing enhancer motifs and generate splicing silencer sequences resulting in the skipping of exon 3. Variants c.305C > T and c.1129G > A probably disturb splice sites leading to exon skipping. Conclusion: To our knowledge, we report, for the first time, SLC5A2 exonic variants that produce alterations in pre-mRNA. Our research reinforces the importance of assessing the consequences for putative point variants at the mRNA level. Additionally, we propose that minigenes function analysis may be valuable to evaluate the impact of SLC5A2 exonic variants on pre-mRNA splicing without patients' RNA samples.

show abstract

Section: In Silico Prediction and Screening Criteriamentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Six Exonic Variants in the SLC5A2 Gene Cause Exon Skipping in a Minigene Assay

Wang

Liu

et al. 2020

Front. Genet.

Self Cite

View full text Add to dashboard Cite

show abstract

“…In previous studies, the variant frequency of c.886(−10_-31) del in the Chinese population was as high as 32% [22,23]. Therefore, we rescreened the observed splice site variants in every patient from the twenty-two Chinese renal glucosuria families that were found in our previous and current studies.…”

Section: Discussionmentioning

confidence: 91%

“…Renal biopsy is not obligatory for FRG patients; therefore, SLC5A2 cDNA from the kidney is almost impossible to obtain. Although there are a few reports about splice-site variants [4,5,22,23], the effect of splice-site variants is very difficult to verify in cDNA. We searched through NCBI GEO profiles and found that the SGLT2 protein can be expressed in peripheral white blood cells and lymphocytes.…”

Section: Discussionmentioning

confidence: 99%

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

Liu

Hou

et al. 2020

BMC Nephrol

View full text Add to dashboard Cite

Background: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. Methods: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. Results: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(−10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_ Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. Conclusion: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(−10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

show abstract

“…In the majority of the inherited form of isolated renal glycosuria, also called familial renal glycosuria, mutations in the SLC5A2 gene coding for the glucose transporter, sodium-glucose co-transporter 2 (SGLT2) are responsible. This transporter is responsible for the reabsorption of the bulk of filtered glucose [4]. Due to the defect in the transporter, the glucose appears in the urine.…”

Section: Introductionmentioning

confidence: 99%

A Case of Isolated Renal Glycosuria from Nepal

Kunwar¹,

Pant²,

Khatiwada³

2020

IJCEMS

View full text Add to dashboard Cite

Isolated renal glycosuria is a rare genetic disease caused by mutations in SLC5A2 gene. The mutation leads to a defect in glucose transporter, sodium-glucose co-transporter 2 (SGLT2), which is involved in the reabsorption of glucose from proximal tubules. Defect in this transporter leads to loss of glucose in urine. This rare disease has not been reported from Nepal previously, and here we report the first case. A 38-year-old female with complaint of tiredness and fatigue visited our medical centre. On clinical examinations, no other signs and symptoms were reported. The patient had no history of any other disease and the patient was not taking any supplements or medications. On repeated laboratory investigations, there were no signs of abnormal glucose metabolism and proximal tubular dysfunction. No evidence of hepatic, renal, and blood disorders, infection, haematuria, and proteinuria was present. Based on clinical and laboratory investigations, the patient was diagnosed as having isolated renal glycosuria. We report the first case of isolated renal glycosuria in Nepal. Because the disease is often asymptomatic, physicians and health professionals need to be aware of this condition which may occur in their community.

show abstract

Identification of ten novel SLC5A2 mutations and determination of the renal threshold for glucose excretion in Chinese patients with familial renal glucosuria

Cited by 9 publications

References 17 publications

Six Exonic Variants in the SLC5A2 Gene Cause Exon Skipping in a Minigene Assay

Six Exonic Variants in the SLC5A2 Gene Cause Exon Skipping in a Minigene Assay

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families

A Case of Isolated Renal Glycosuria from Nepal

Contact Info

Product

Resources

About