Identification of Sarcocystis spp. in One-humped Camels (Camelus dromedarius) from Riyadh and Dammam, Saudi Arabia, via Histological and Phylogenetic Approaches

Metwally, Dina M.; Al-Otaibi, Tahani; Al-Turaiki, Isra; El‐Khadragy, Manal F.; Alajmi, Reem A.

doi:10.3390/ani10071108

Cited by 8 publications

(13 citation statements)

References 35 publications

(45 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…This study has helped to extend the findings of previous studies on choke in dromedary camels. It also complements other studies of oesophageal disorders in dromedary camels which have, separately, reported that lesions of sarcocystosis are commonly found in oesophageal tissues 31 …”

Section: Discussionsupporting

confidence: 83%

See 1 more Smart Citation

A retrospective study of choke (oesophageal obstruction) in 64 one‐hump Dromedary camels (Camelus dromedarius) in Saudi Arabia

Zabady

Shawaf

2022

Veterinary Record Open

View full text Add to dashboard Cite

Background Choke (oesophageal obstruction) is an important oesophageal disorder in large domestic animals. Published studies on choke in the dromedary camel ( Camelus dromedarius ) are few in number and deal with small number of cases. Methods Sixty‐four camels with choke were presented to the Veterinary Teaching Hospital, King Faisal University. History, breed, age, sex, duration of obstruction and clinical signs were recorded. The diagnosis was established using examination with a stomach tube, oesophageal radiography and endoscopy. Choke was managed either by using alligator forceps guided endoscope or by cervical oesophagotomy. Results Choke was recorded in camels less than 1 year old (84.38%) more than camels more than 1 year of age (15.62%) and complete obstruction more than partial. Most cases had obstruction involving the cervical oesophagus (96.87%). In the majority of obstructive masses, there were pieces of fabric (48.44%) and plastic bags (35.94%). Most obstructive masses were slightly radio‐opaque (62.5%). Surgical and non‐surgical managements were effective (91.3% and 94.44%, respectively) in resolving the choke. Conclusions Choke was most likely in animals less than 1 year of age with complete obstruction of the cervical oesophagus. Surgical and non‐surgical methods were effective in resolving the choke in the dromedary camels. It was not practical to use forceps extraction in all adult camels due to the limited length of the alligator forceps.

show abstract

Section: Discussionsupporting

confidence: 83%

“…It also complements other studies of oesophageal disorders in dromedary camels which have, separately, reported that lesions of sarcocystosis are commonly found in oesophageal tissues. 31 …”

Section: Discussionmentioning

confidence: 99%

A retrospective study of choke (oesophageal obstruction) in 64 one‐hump Dromedary camels (Camelus dromedarius) in Saudi Arabia

Zabady

Shawaf

2022

Veterinary Record Open

View full text Add to dashboard Cite

show abstract

“…(S. aucheniae or S. masoni) from camels and suggests identification of Sarcocystis spp. with more taxa and different molecular markers, including 18S rRNA and cox 1 (15). Mohamed et al (26) also suggested using the hybrid approach to characterize the microbe, including Next-Generation Sequencing and conventional PCR combined with Sanger sequencing, and also using RFLP-PCR for characterization of Sarcocystis isolated from camel (27).…”

Section: Discussionmentioning

confidence: 99%

“…In addition, PCR was performed to amplify a segment of the mitochondrial cytochrome c oxidase subunit 1 gene (cox 1) using the specific primer pairs of SF1 (ATGGCGTACAACAATCATAAAGAA) and SR9 (ATATCCATACCRCCATTGCCCAT). The amplified PCR product was approximately 1038 bp (14,15), and both negative and positive controls were included. The PCR products were sent to Shanghai Sangon Company (China) for bi-directional sequencing on an ABI PRISM TM 3730 XL DNA Analyzer using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA).…”

Section: Molecular Analysis Of Sarcocystismentioning

confidence: 99%

First Report of Sarcocystis Masoni in a Captive Alpaca (Vicugna Pacos) From China

et al. 2021

View full text Add to dashboard Cite

Background: Sarcocystosis is a parasitic disease caused by intracellular protozoan parasite of the genus Sarcocystis. Tissue samples of alpacas (n = 4) from Henan province (China) were screened for Sarcocystis spp. infection by histological examination, pepsin digestion, and molecular assays.Results:Sarcocystis spp. was detected in heart, liver, spleen, lung, and kidney of an alpaca by molecular assays. Many sarcocysts with inflammation responses were observed in this alpaca myocardium, and they showed a high similarity to Sarcocystis masoni by sequence analysis.Conclusion: This study is the first to demonstrate Sarcocystis spp. infection in alpaca from China. The higher parasite load in the alpaca myocardium indicated that it had contact with an environment contaminated with sporocysts, and that the alpaca was susceptible to Sarcocystis spp.

show abstract

“…In this regard, the digestion method and histopathological analysis have been implemented for the analysis of microscopic sarcocysts in camels. Moreover, ultrastructural analysis, using transmission electron microscopy of the cyst wall appears very useful in the identification of sarcocysts [ 55 ]. Furthermore, several serological techniques, including enzyme-linked immunosorbent assay and an indirect fluorescent antibody test, were used for diagnosing infection.…”

Section: Discussionmentioning

confidence: 99%

Epidemiological and Histopathological Investigation of Sarcocystis spp. in Slaughtered Dromedary Camels (Camelus dromedarius) in Egypt

Gareh

Soliman

Saleh

et al. 2020

Veterinary Sciences

View full text Add to dashboard Cite

Sarcocystosis is considered one of the major parasitic diseases with a worldwide distribution. It is caused by the obligatory intracellular protozoan parasites of the genus Sarcocystis. Besides its public health issues, sarcocystosis results in significant economic losses due to its impact on productivity and milk yield. A wide range of final and intermediate hosts have been identified, including mammals, birds, and reptiles; however, few studies have investigated the contribution of camels to maintaining the epidemiological foci of the disease in countries such as Egypt. The present study was conducted to grossly and histopathologically identify the prevalence rate of Sarcocystis spp. in camels (N = 100) from the Aswan Governorate, Egypt. Furthermore, the major risk factors related to the development of sarcocystosis in camels were investigated. Samples from the diaphragm, cardiac muscle, esophagus, and testes of the slaughtered camels were collected. Interestingly, Sarcocystis was detected in 75% of the examined camels. Following the studied variable factors, camels aged 5 years or more were found to be at higher risk, with an infection rate of 87.7% (57 of 65) than those younger than 5 years. The infection rate was 81.4% (57 of 70) in males and 60% (18 of 30) in females. The esophagus was the most affected organ (49%), followed by the diaphragm (26%) and cardiac muscle (17%), whereas none of the testes samples were affected. Taken together, the present study demonstrates the high prevalence of Sarcocystis in the examined camels and suggests the importance of these animals in preserving the epidemiological foci of sarcocystosis in Egypt. Future research should map the circulating strains in Egypt and aim to raise public health awareness about the importance of sarcocystosis and other related zoonotic diseases.

show abstract

Identification of Sarcocystis spp. in One-humped Camels (Camelus dromedarius) from Riyadh and Dammam, Saudi Arabia, via Histological and Phylogenetic Approaches

Cited by 8 publications

References 35 publications

A retrospective study of choke (oesophageal obstruction) in 64 one‐hump Dromedary camels (Camelus dromedarius) in Saudi Arabia

A retrospective study of choke (oesophageal obstruction) in 64 one‐hump Dromedary camels (Camelus dromedarius) in Saudi Arabia

First Report of Sarcocystis Masoni in a Captive Alpaca (Vicugna Pacos) From China

Epidemiological and Histopathological Investigation of Sarcocystis spp. in Slaughtered Dromedary Camels (Camelus dromedarius) in Egypt

Contact Info

Product

Resources

About