Identification of reference miRNAs in plasma useful for the study of oestrogen-responsive miRNAs associated with acquired Protein S deficiency in pregnancy

Tay, Jasmine W.; James, Ian; Hughes, Q.; Tiao, Janice; Baker, Ross

doi:10.1186/s13104-017-2636-3

Cited by 20 publications

(27 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Of particular interest were CXCL13, BTLA, IL7R, LAMP3, and LTB as these genes have been linked to the presence of tertiary lymphoid structures (TLS) and high endothelial venules (HEV) within tumors. TIF miR-146a and miR-494, the most interconnected and co-abundant miRNAs in this cluster, were both previously annotated as negative regulators of immune-stimulatory genes and were DE in the plasma from patients with BC [158,192]. As tumor immune cell infiltration is highly related to patient prognosis [2], we propose genes and miRNA from this module to be candidate markers of tumor immune status, prognosis, and potentially patient response to immunotherapy.…”

Section: Resultsmentioning

confidence: 85%

Secreted breast tumor interstitial fluid microRNAs and their target genes are associated with triple-negative breast cancer, tumor grade, and immune infiltration

et al. 2020

View full text Add to dashboard Cite

Background: Studies on tumor-secreted microRNAs point to a functional role of these in cellular communication and reprogramming of the tumor microenvironment. Uptake of tumor-secreted microRNAs by neighboring cells may result in the silencing of mRNA targets and, in turn, modulation of the transcriptome. Studying miRNAs externalized from tumors could improve cancer patient diagnosis and disease monitoring and help to pinpoint which miRNA-gene interactions are central for tumor properties such as invasiveness and metastasis. Methods: Using a bioinformatics approach, we analyzed the profiles of secreted tumor and normal interstitial fluid (IF) microRNAs, from women with breast cancer (BC). We carried out differential abundance analysis (DAA), to obtain miRNAs, which were enriched or depleted in IFs, from patients with different clinical traits. Subsequently, miRNA family enrichment analysis was performed to assess whether any families were over-represented in the specific sets. We identified dysregulated genes in tumor tissues from the same cohort of patients and constructed weighted gene co-expression networks, to extract sets of co-expressed genes and co-abundant miRNAs. Lastly, we integrated miRNAs and mRNAs to obtain interaction networks and supported our findings using prediction tools and cancer gene databases.

show abstract

Section: Resultsmentioning

confidence: 85%

Secreted breast tumor interstitial fluid microRNAs and their target genes are associated with triple-negative breast cancer, tumor grade, and immune infiltration

et al. 2020

View full text Add to dashboard Cite

show abstract

“…In the case of plasma samples, cells can be inadvertently aspirated during collection. The large differences observed using Nanostring are distinct from those reported using RT-PCR for detection of miRNA in a limited sample set [ 14 ]. A potential explanation for this could be that differences in the amount of very low abundant transcripts may not have been adequately detected by PCR, but were identified using Nanostring which does not rely on amplification of circulating transcripts.…”

Section: Discussionmentioning

confidence: 89%

Comparison of miRNA quantitation by Nanostring in serum and plasma samples

et al. 2017

View full text Add to dashboard Cite

Circulating microRNAs that are associated with specific diseases have garnered much attention for use in diagnostic assays. However, detection of disease-associated miRNA can be affected by several factors such as release of contaminating cellular miRNA during sample collection, variations due to amplification of transcript for detection, or controls used for normalization for accurate quantitation. We analyzed circulating miRNA in serum and plasma samples obtained concurrently from 28 patients, using a Nanostring quantitative assay platform. Total RNA concentration ranged from 32–125 μg/ml from serum and 30–220 μg/ml from plasma. Of 798 miRNAs, 371 miRNAs were not detected in either serum or plasma samples. 427 were detected in either serum or plasma but not both, whereas 151 miRNA were detected in both serum and plasma samples. The diversity of miRNA detected was greater in plasma than in serum samples. In serum samples, the number of detected miRNA ranged from 3 to 82 with a median of 17, whereas in plasma samples, the number of miRNA detected ranged from 25 to 221 with a median of 91. Several miRNA such as miR451a, miR 16-5p, miR-223-3p, and mir25-3p were highly abundant and differentially expressed between serum and plasma. The detection of endogenous and exogenous control miRNAs varied in serum and plasma, with higher levels observed in plasma. Gene expression stability identified candidate invariant microRNA that were highly stable across all samples, and could be used for normalization. In conclusion, there are significant differences in both the number of miRNA detected and the amount of miRNA detected between serum and plasma. Normalization using miRNA with constant expression is essential to minimize the impact of technical variations. Given the challenges involved, ideal candidates for blood based biomarkers would be those that are indifferent to type of body fluid, are detectable and can be reliably quantitated.

show abstract

“…miR-33a-5p (478347_mir GTGCATTGTAGTTGCATTGCA, ThermoFisher Scientific, Waltham, USA) was detected by the TaqMan 1 Advanced miRNA Assays (A25576, ThermoFisher Scientific, Waltham, USA) in liver. The spike miR-39-3p (C. elegans) [56] (478293_mir TCACCGGG TGTAAATCAGCTTG, ThermoFisher Scientific, Waltham, USA) was used for miR-33a normalization and it was present at relatively constant levels among the treatments. Total RNA in liver was obtained in the same way as that for gene expression analysis.…”

Section: Mirna Expression Analysis In Liver Hepatocytes and Plasmamentioning

confidence: 99%

Cholesterol metabolism regulation mediated by SREBP-2, LXRα and miR-33a in rainbow trout (Oncorhynchus mykiss) both in vivo and in vitro

et al. 2020

View full text Add to dashboard Cite

Cholesterol metabolism is greatly affected in fish fed plant-based diet. The regulation of cholesterol metabolism is mediated by both transcriptional factors such as sterol regulatory element-binding proteins (SREBPs) and liver X receptors (LXRs), and posttranscriptional factors including miRNAs. In mammals, SREBP-2 and LXRα are involved in the transcriptional regulation of cholesterol synthesis and elimination, respectively. In mammals, miR-33a is reported to directly target genes involved in cholesterol catabolism. The present study aims to investigate the regulation of cholesterol metabolism by SREBP-2 and LXRα and miR-33a in rainbow trout using in vivo and in vitro approaches. In vivo, juvenile rainbow trout of~72 g initial body weight were fed a total plant-based diet (V) or a marine diet (M) containing fishmeal and fish oil. In vitro, primary cell culture hepatocytes were stimulated by graded concentrations of 25-hydroxycholesterol (25-HC). The hepatic expression of cholesterol synthetic genes, srebp-2 and miR-33a as well as miR-33a level in plasma were increased in fish fed the plant-based diet, reversely, their expression in hepatocytes were inhibited with the increasing 25-HC in vitro. However, lxrα was not affected neither in vivo nor in vitro. Our results suggest that SREBP-2 and miR-33a synergistically enhance the expression of cholesterol synthetic genes but do not support the involvement of LXRα in the regulation of cholesterol elimination. As plasma level of miR-33a appears as potential indicator of cholesterol synthetic capacities, this study also highlights circulating miRNAs as promising noninvasive biomarker in aquaculture.

show abstract

Identification of reference miRNAs in plasma useful for the study of oestrogen-responsive miRNAs associated with acquired Protein S deficiency in pregnancy

Cited by 20 publications

References 70 publications

Secreted breast tumor interstitial fluid microRNAs and their target genes are associated with triple-negative breast cancer, tumor grade, and immune infiltration

Secreted breast tumor interstitial fluid microRNAs and their target genes are associated with triple-negative breast cancer, tumor grade, and immune infiltration

Comparison of miRNA quantitation by Nanostring in serum and plasma samples

Cholesterol metabolism regulation mediated by SREBP-2, LXRα and miR-33a in rainbow trout (Oncorhynchus mykiss) both in vivo and in vitro

Contact Info

Product

Resources

About