Identification of genes encoding glycosyltransferases involved in lipopolysaccharide synthesis in <i>Porphyromonas gingivalis</i>

Shoji, Mikio; Satô, Keiko; Yukitake, Hideharu; Kamaguchi, Arihide; Sasaki, Yuko; Naito, Mariko; Nakayama, Koji

doi:10.1111/omi.12200

Cited by 24 publications

(36 citation statements)

References 54 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…PorR is involved in the Wbp pathway that leads to the biosynthesis of A-LPS (Shoji et al 2018). We have identified the PorR motifs that matched the motifs from the DegT family.…”

Section: Discussionmentioning

confidence: 94%

Identification of Sequence Motifs for the Protein Components of Type IX Secretion System

Emrizal

Muhammad

2018

JSM

View full text Add to dashboard Cite

Porphyromonas gingivalis is the bacterium responsible for chronic periodontitis, a severe periodontal disease. Virulence factors produced by this bacterium are secreted by the Type IX Secretion System (T9SS). The specific functions for each protein component of the T9SS have yet to be characterized thus limiting our understanding of the mechanisms associated with the translocation and modification processes of the T9SS. This study aims to identify the sequence motifs for each T9SS component and predict the functions associated with each discovered motif using motif comparisons. We extracted the sequences of 20 T9SS components from the P. gingivalis proteome that were experimentally identified to be important for T9SS function and used them for homology searching against fully sequenced bacterial proteomes. We developed a rigorous pipeline for the identification of seed sequences for each protein family of T9SS components. We verified that each selected seed sequence are true members of the protein family hence sharing conserved sequence motifs using profile Hidden Markov Models. The motifs for each T9SS component are identified and compared to motifs in the Pfam database. The discovered motifs for 11 components with known functions matched the motifs associated with the reported functions. We also suggested the putative functions for four components. PorM and PorW might form the putative energy transduction complex. PorP and PorT might be the putative O-deacylases. The identified motifs for five components matched the motifs associated with functions that related/unrelated to the T9SS.

show abstract

“…PorR is involved in the Wbp pathway that leads to the biosynthesis of A-LPS (Shoji et al 2018). We have identified the PorR motifs that matched the motifs from the DegT family.…”

Section: Discussionmentioning

confidence: 94%

Identification of Sequence Motifs for the Protein Components of Type IX Secretion System

Emrizal

Muhammad

2018

JSM

View full text Add to dashboard Cite

show abstract

“…[ATATCAAACAGGATCCCCCGATAGCTTCCG]/ermF-R: [ATAAGGCCCCGGATCCCCTACGAAGGATGA] using the genome of gtfF (PGN_1668)::ermF mutant (KDP611) as a template [24]. Using the three purified products, PCR was performed with pad-Up-F/ pad-Dw-R.…”

Section: Construction Of Pg Knockout Mutantmentioning

confidence: 99%

Effect of Porphyromonas gingivalis infection on gut dysbiosis and arthritis exacerbation in mouse model

Hamamoto

Ouhara

Munenaga³

et al. 2020

Preprint

View full text Add to dashboard Cite

Background: Porphyromonas gingivalis (Pg) infection causes periodontal disease and is involved in the exacerbation of rheumatoid arthritis (RA). Gut microbiota dysbiosis has shown strong associations with systemic diseases, including RA, diabetes mellitus, and inflammatory bowel disease, and inoculation of periodontopathogenic bacteria (i.e. Pg) can alter gut microbiota composition. Therefore, this study investigated dysbiosis-mediated arthritis exacerbation by Pg oral inoculation in an experimental arthritis model mouse.Methods: Pg inoculation in the oral cavity twice a week for 6 weeks was performed to induce periodontitis in SKG mice. Concomitantly, a single intraperitoneal (i.p.) injection of laminarin (LA) was administered to induce experimental arthritis (Pg-LA mouse). Citrullinated protein (CP) and IL-6 levels in periodontal, intestinal, and joint tissues, and serum were measured by ELISA. Gut microbiota composition was determined by sequencing the bacterial 16S rRNA after DNA purification of mouse feces. Fecal microbiota transplantation (FMT) was performed by transferring Pg-RA-derived feces to normal SKG mice. The effect of the Pg peptidylarginine deaminase (PgPAD) on the level of citrullinated proteins and arthritis progression were determined using PgPAD knockout mutant.Results: Periodontal alveolar bone loss and IL-6 in gingival tissue were induced by Pg oral infection, as well as severe joint destruction, increased arthritis scores (AS), and IL-6 and CP production in serum, joint, and intestinal tissues. Distribution of Deferribacteres and S24-7 was decreased, while CP was significantly increased in gingival, joint, and intestinal tissues of Pg-inoculated experimental arthritis mice compared to experimental arthritis mice without Pg inoculation. Further, FMT from Pg-inoculated experimental arthritis mice showed the reproduction of donor gut microbiota and resulted in severe joint destruction with increased IL-6 and CP production in joint and intestinal tissues. The avarage AS of FMT from Pg-inoculated experimental arthritis was much higher than that of donor mouse. However, inoculation of the PgPAD knockout mutant inhibited the elevation of arthritis scores, ACPA level in serum and reduced CP amount in gingival, joint, and intestinal tissues compared to Pg wild type inoculation .Conclusion: Pg oral infection affected gut microbiota dysbiosis and joint destruction via increased CP generation.

show abstract

“…Tn insertion had occurred at different positions in these mutants at a high frequency (85.5%). The ermF-ITR insertion sites were found mostly in the coding regions, and some in the 5′-intergenic regions, of the 55 genes including kgp (Tables 1, 2) (2,6,14,(16)(17)(18)(19)(20)(21)(22)(23)(24)(29)(30)(31)(32)(33)(34)(35)(36)(37)(38)(39)(40)(41)(42)(43)(44)(45).…”

Section: Mariner-based Tn Mutagenesis For the Exhaustive Isolation mentioning

confidence: 99%

PGN_0297 is an essential component of the type IX secretion system (T9SS) in Porphyromonas gingivalis: Tn‐seq analysis for exhaustive identification of T9SS‐related genes

Naito

Tominaga

Shoji

et al. 2019

Microbiology and Immunology

View full text Add to dashboard Cite

The type IX secretion system (T9SS) was originally discovered in Porphyromonas gingivalis, one of the pathogenic bacteria associated with periodontal disease and is now known to be present in many members of the phylum Bacteroidetes. The T9SS secretes a number of potent virulence factors, including the highly hydrolytic proteases called gingipains, across the outer membrane in P. gingivalis. To understand the entire machinery of T9SS, an exhaustive search for T9SS‐related genes in P. gingivalis using the mariner family transposon (Tn) and Tn‐seq analysis was performed. Seven hundred and two Tn insertion sites in Tn mutants with no colony pigmentation that is associated with Lys‐gingipain (Kgp) defectiveness were determined, and it was found that the Tn was inserted in the kgp gene and 54 T9SS‐related candidate genes. Thirty‐three out of the 54 genes were already known as T9SS‐related genes. Furthermore, deletion mutant analysis of the remaining 21 genes revealed that they were not related to the T9SS. The 33 T9SS‐related genes include a gene for PGN_0297, which was found to be associated with the T9SS components PorK and PorN. A PGN_0297 gene deletion mutant was constructed, and it was found that the mutant showed no colony pigmentation, hemagglutination or gingipain activities, indicating that PGN_0297 was an essential component of the T9SS. The 33 genes did not include the six genes (gppX, omp17, porY, rfa, sigP and wzx) that were also reported as T9SS‐related genes. gppX deletion and insertion mutants were constructed, and it was found that they did not show deficiency in the T9SS.

show abstract

Identification of genes encoding glycosyltransferases involved in lipopolysaccharide synthesis in Porphyromonas gingivalis

Cited by 24 publications

References 54 publications

Identification of Sequence Motifs for the Protein Components of Type IX Secretion System

Identification of Sequence Motifs for the Protein Components of Type IX Secretion System

Effect of Porphyromonas gingivalis infection on gut dysbiosis and arthritis exacerbation in mouse model

PGN_0297 is an essential component of the type IX secretion system (T9SS) in Porphyromonas gingivalis: Tn‐seq analysis for exhaustive identification of T9SS‐related genes

Contact Info

Product

Resources

About