Identification of four new Kudoa spp. (Myxozoa: Myxosporea: Multivalvulida) in commercial fishes collected from South China Sea, Atlantic Ocean, and Bering Sea by integrated taxonomic approach

First report of a Kudoa lutjanus outbreak in farmed Chicken Grunts Parapristipoma trilineatum

“…2005; Li et al. 2020a, 2020b), indicating that the myxosporean isolated from the Chicken Grunts belongs to K. lutjanus . Furthermore, we provided additional information on K. lutjanus tissue tropism and host specificity.…”

“…The primer pair for LSU rRNA was 28S‐2F (5′‐GGCAAGACTACCTGCTGAAC‐3′) and 28S‐2132R (5′‐AGAGGCTGTTCACCTTGGAG‐3′; Li et al. 2020a). The polymerase chain reaction (PCR) was conducted in a 25‐μL reaction mixture containing 0.2‐mM deoxynucleotide triphosphate (TOYOBO), 0.125‐μM each primer, 1× PCR Buffer for Blend Taq (TOYOBO), 1 U Blend Taq (TOYOBO), and DNase‐free distilled water (Invitrogen) to achieve a final volume of 25 μL.…”

“…An amplicon with a length of approximately 2080 bp was amplified from the LSU rRNA gene by using the following steps: 10 min at 95°C; 35 cycles of denaturation for 1 min at 95°C, annealing for 1 min at 58°C, and extension for 1 min 50 s at 72°C; and a final extension for 10 min at 72°C (Li et al. 2020a).…”

The ‘jellied’ or ‘mushy’ condition of fish in the North Atlantic and North Pacific fisheries: Characteristics, causes and consequences

“…Kudoa sp. reported by Davis (1924) is now named Kudoa aburakarei [ 56 ]. Red barracuda ( Sphyraena pinguis ) [ 57 ] Parasitic (Kudoa megacapsula) Sablefish ( Anoplopoma fimbria ) [ [16] , [17] , [18] ] No causative agent identified – possibly genetic variability or environmental factors and reproductive strategy Skipjack tuna ( Katsuwonus pelamis ) [ 58 ] Post mortem endogenous proteolytic activity, stress during capture and insufficient cooling post-harvest Spotted wolffish ( Ana hichas minor ) [ 41 ] Parasitic (Kudoa islandica) Swordfish ( Xiphsias gladius ) [ 59 , [60] , [61] , [62] , [63] ] Parasitic (Kudoa musculoliquefaciens) Yellowfin tuna ( Thunnus albacares ) [ 64 ] Parasitic ( Kudoa neothunni ) Yellowfin tuna ( Thunnus albacares ) [ 65 , 66 ] Post mortem endogenous proteolytic activity, stress during capture and insufficient cooling post-harvest a Reports on Kudoa infections have only been included if jelly-like quality deterioration or myoliquefaction is documented as a consequence.…”