Identification of first exfoliative toxin inStaphylococcus pseudintermedius

Abstract

Staphylococcus aureus, Staphylococcus hyicus, and Staphylococcus chromogenes are known to cause skin infections in human or animals by producing exfoliative toxins (ETs). Staphylococcus pseudintermedius can also cause canine pyoderma, but no exfoliative toxins or similar toxins have been reported. PCR with degenerate primers targeted to the conserved regions in ETA, ETB, and ETD from S. aureus and SHETB from S. hyicus, and subsequent chromosome walking identified a novel gene, designated as exi (exfoliative toxin of pseudintermedius) in S. pseudintermedius. EXI had significant homologies with the exfoliative toxins (43-68% identity), particularly with ETB (67.1%), ETD (67.9%), and SHETB (65.1%). Phylogenetic analysis showed close relation between EXI and ETB with a bootstrap value of 80%. Neonatal mice injected with the crude proteins from the culture supernatant or recombinant EXI showed gross blisters and/or characteristic skin exfoliation. The prevalence of exi assessed by dot-blot hybridization was 23.3% (10/43) in S. pseudintermedius isolates from canine pyoderma. The EXI reported herein is the first exfoliative toxin identified in S. pseudintermedius.

Coagulase-positive Staphylococcus pseudintermedius from animals causing human endocarditis

“…This simple identification procedure may lead to the misidentification of some coagulase-positive species, such as S. intermedius or S. pseudintermedius, although these species are rarely isolated in clinical bacteriology (Mahoudeau et al, 1997;Van Hoovels et al, 2006). A novel exfoliative toxin, EXI, closely related to S. aureus ETB, was recently identified in 23.3% of S. pseudintermedius isolates from canine cases of pyoderma (Futagawa-Saito et al, 2009). The characteristics of the isolate are in accordance with the characteristics previously reported for S. pseudintermedius (Table 1).…”

Sharing More than Friendship — Nasal Colonization with Coagulase-Positive Staphylococci (CPS) and Co-Habitation Aspects of Dogs and Their Owners

“…PCR-based detection of the bicomponent leukotoxin Luk-I ( luk S and luk F) was carried out as described previously [31]. The presence of the exfoliative toxin ExpA (formerly named EXI) was determined by PCR with the primers exp A-F GCGCGTCCTTCTGATCCAGAACT and exp A-R AACGTCCCCCTTTACCTACGTGAAT (according to AB489850.1, [32] at an annealing temperature of 58°C (25 cycles) including strain IMT21652 (JN604832) as a positive control. Detection of the gene encoding ExpB was performed as described previously [33].…”

Comparative RNA-seq-Based Transcriptome Analysis of the Virulence Characteristics of Methicillin-Resistant and -Susceptible Staphylococcus pseudintermedius Strains Isolated from Small Animals

“…The eBURST algorithm identified groups of related sequence types (ST) (10). Specific sequences for virulence genes involved in biofilm formation (bap, icaA, icaB, icaC, and icaD), enterotoxin production (se-int, sec canine , and seh), host adherence (ebpS, spsD, spsL, and spsO), and toxin production (lukS, lukF, siet, speta, expA, and expB) were detected by PCR on a Mastercycle thermocycler (Eppendorf, New York) with the primers, product sizes, and annealing temperatures shown in Table S1 in the supplemental material (11)(12)(13)(14)(15)(16). The primers designed in this study were generated using the Primer-BLAST tool from NCBI.…”