Identification of expressed genes by laser-mediated manipulation of single cells

Abstract

We describe a rapid noncontact method for the capture of single cells or small tissue areas of any size or shape directly within the cap of a common microfuge tube. Prior to the laser-mediated transfer, the specimen is isolated by laser microbeam microdissection, forming a clear-cut gap around the selected area. Laser treatment does not impair subsequent RNA analysis. We have used this method to isolate a single cell from archival colon adenocarcinoma, and were able to detect point mutations within codon 12 of c-Ki-ras2 mRNA after nested RT-PCR analysis.

Biophysical Response to Pulsed Laser Microbeam‐Induced Cell Lysis and Molecular Delivery

“…As a result, there is an increasing interest to use pulsed laser microbeams for precise cellular manipulation, including laserinduced cell lysis [1], cell microdissection and catapulting [2][3][4][5], cell collection, expansion, and purification [6][7][8], cellular microsurgery [9][10][11], and cell membrane permeabilization for the delivery of membrane-impermeant molecules into cells [12 15], The processes of laser-induced optoinjection and optoporation offer the ability to load cells with a variety of biomolecules on short time scales (milliseconds to seconds) through optically produced cell membrane permeabilization [12,14,15], Despite the innovative utilization of laser microbeams in cell biology and biotechnology, only recently have studies provided insight regarding the mechanisms that mediate the interactions of highly focused pulsed laser beams with cells [16][17][18][19][20][21][22], A better understanding of these processes will prove critical to the continued development of laser microbeams for both research and practical applications. In previous studies, we provided a detailed characterization of the physics involved in the interaction of highly-focused nanosecond laser microbeams with cells [19,20], However, it is important to relate these physical effects to the biological response of the cells.…”

p53 mutation profiling of multiple esophageal carcinoma using laser capture microdissection to demonstrate field carcinogenesis

“…14,15 Recent studies using laser-assisted microdissection from tissue sections have provided an insight into the biology of not only different diseases, including breast cancer, 16 malignant lymphoma, 17 lung cancer 18 and pancreatic cancer, 19 but also normal skin. 20 In our study.…”

High Frequency of Autologous Anti-Melanoma CTL Directed Against an Antigen Generated by a Point Mutation in a New Helicase Gene

“…Poly(A) ϩ RNA was enriched with an oligo(dT)-cellulose column (Pharmacia Biotech, Uppsala, Sweden) and converted to cDNA with the Superscript Choice System (Life Technologies, Gaithersburg, MD) using an oligo(dT) primer (5Ј-ATAAGAATGCGGCC GCTAAACTA(T) 18 VZ with V ϭ G or A or C; Z ϭ G or A or T or C) containing a NotI site. The cDNA was ligated to HindIII-EcoRI adaptors (Stratagene, Heidelberg, Germany), phosphorylated, digested with NotI, and inserted into the HindIII and NotI sites of expression vector pCEP4 (Invitrogen, San Diego, CA).…”

“…For the primary melanoma sample from 1985, tumoral tissue from five sections was first microdissected from the normal surrounding tissue with a microdissection laser microscope (P.A.L.M. Mikrolaser Technologie, Wolfratshausen, Germany) (18). Regions of the MUM-1, -2, and -3 genes that encode the antigenic peptides were amplified with PCR using the following forward and reverse primers: MUM-1, OPC194 (5Ј-AGTTTGCCACTGTTTCTCACTGTC) and OPC195 (5Ј-CAAAC TAGTTGCTTTCTCATGAGGTTA); MUM-2, OPC744 (5Ј-CTCCCAC CACCACTTTCTCCT) and OPC712 (5Ј-GGCCCCAGGCAGACAT GAATT); and MUM-3, OPC743 (5Ј-CAATGTGTTCATCAGATTCC TTCTG) or OPC436 (5Ј-CTACCACCACACATCCTAACAAGATTA) and OPC455 (5Ј-CCAAGTGAAATCAGCATAGATGCTG), or OPC797 (5Ј-CTCTGAAATCCCATTTACAAGTCAG) and OPC798 (5Ј-TACCTGAT CATTCCAAGTGAAATCAG).…”