Identification of Exogenous Forms of Human-Tropic Porcine Endogenous Retrovirus in Miniature Swine

Wood, James C. S.; Quinn, Gary; Suling, Kristen M.; Oldmixon, Beth A.; Tine, Brian A. Van; Cina, Robert A.; Arn, Scott; Huang, Chichi; Scobie, Linda; Onions, David; Sachs, David H.; Schuurman, Henk‐Jan; Fishman, Jay A.; Patience, Clive

doi:10.1128/jvi.78.5.2494-2501.2004

Cited by 130 publications

(158 citation statements)

References 38 publications

Supporting

Mentioning

151

Contrasting

Order By: Relevance

“…Infection cannot be prevented within a pig, since it is embedded in the genome. Recent reports however indicate that the human-tropic form of PERV may, in some pig breeds, be an exogenous infection [36], and that the pig germline may not contain a replicationcompetent human-tropic PERV. Perhaps a selective breeding program of pigs that do not contain humantropic PERV sequences in the germline would allow development of a herd that are less likely to express the human-tropic PERV.…”

Section: Porcine Retrovirusesmentioning

confidence: 99%

Diseases in swine transmitted by artificial insemination: An overview

et al. 2008

View full text Add to dashboard Cite

Artificial insemination (AI) of swine is widely practiced in countries with an intensive pig production. It is a very useful tool to introduce superior genes into sow herds, with minimal risk for disease transmission. However, the impact of semen that is contaminated with pathogens can be enormous. Most of the micro-organisms that have been detected in boar semen are considered non-pathogenic, but some are known pathogens (e.g. porcine reproductive and respiratory syndrome virus) that can cause major economic losses. Microbial contamination of semen can be due to systemic and/or urogenital tract infections of the boar, or can occur during collection, processing and storage. It can result in reduced semen quality, embryonic or fetal death, endometritis and systemic infection and/or disease in the recipient female. Conventional techniques for isolation of bacteria and viruses from the semen do not always provide optimal results for various reasons, including lack of sensitivity and speed of testing, and difficult interpretation of the outcome. More recently, PCR tests are commonly used; they have a high sensitivity, the outcome is quickly obtained, and they are suitable for monitoring a large number of samples. The best strategy to prevent AI-transmitted diseases is to use boars that are free of specific pathogens, to monitor the animals and semen regularly, and to maintain very high biosecurity. Additional measures should be directed at treating semen with appropriate antimicrobials, and at reducing contamination during semen collection, processing, and storage. #

show abstract

Section: Porcine Retrovirusesmentioning

confidence: 99%

Diseases in swine transmitted by artificial insemination: An overview

et al. 2008

View full text Add to dashboard Cite

show abstract

“…Indeed, data has shown that miniature swine do not maintain their transmission status. For example Wood et al demonstrated that during one 14 month interval, several adolescent miniature swine that were initially capable of infecting pig cells only (non-transmitters) eventually infected human cells thus converting to the transmitter phenotype (Wood et al, 2004). It is unclear if this phenomenon is applicable for other pig breeds, nevertheless any monitoring program of donor SPF herds should include a periodic screening for infectious PERV.…”

Section: Perv Infectivity In Vitro -The Gold Standardmentioning

confidence: 99%

“…Another important aspect to consider is the ability of PERV-A and PERV-C to recombine as there is evidence that PERV A/C recombinants show higher titres when cultured in human cells in vitro (Bartosch et al, 2004;Oldmixon et al, 2002;Wilson, Wong, VanBrocklin, & Federspiel, 2000;Wood et al, 2004). As discussed earlier, using the co-culture infectivity test with human HEK293 and swine St Iowa target cell lines, it was established that primary cells (PBMCs) from NZ donor pigs do not release either xeno-or ecotropic infective viruses Garkavenko, Wynyard, Nathu, Simond, et al, 2008).…”

Section: Perv Recombinantsmentioning

confidence: 99%

“…Thus it was concluded that the New Zealand SPF pigs could be classified as non-transmitters for PERV, possessing the "null" transmission phenotype. The term "null", as coined by (Wood et al, 2004), simply means that despite the presence of PERV-A, PERV-B and PERV-C sequences in the genome of these pigs they lack the ability to infect human or pig cells in vitro. This method must be considered the gold standard for determining PERV infectious risk and should be considered compulsory when evaluating new donor herds.…”

Section: Perv Infectivity In Vitro -The Gold Standardmentioning

confidence: 99%

See 1 more Smart Citation

Developing Xenostandards for Microbiological Safety: New Zealand Experience

Garkavenko¹,

Wynyard²,

Nathu³

et al. 2012

Xenotransplantation

View full text Add to dashboard Cite

“…They did not carry PERV-C and were therefore unable to generate PERV-A/C. Blood was taken from the animals 1, 2, 3 and 4 months after inoculation and analysed for the presence of PERV-A/C by PCR using the primers PERV-A VRBF (CCTACCAGTTATAATCAATTTAATTATGGC) and PERV-C env TMR (CTCAAACCACCCTTGAGTAGTTTCC) [3]. This PCR recognizes 0.00026 copies per cell, as estimated by dilution of a PERV-A/C plasmid with pig DNA.…”

mentioning

confidence: 99%