Identification of a Suppressor Mutation That Improves the Yields of Hexon-Modified Adenovirus Vectors

Abstract

We have generated hexon-modified adenovirus serotype 5 (Ad5) vectors that are not neutralized by Ad5-specific neutralizing antibodies in mice. These vectors are attractive for the advancement of vaccine products because of their potential for inducing robust antigen-specific immune responses in people with prior exposure to Ad5. However, hexon-modified Ad5 vectors displayed an approximate 10-fold growth defect in complementing cells, making potential vaccine costs unacceptably high. Replacing hypervariable regions (HVRs) 1, 2, 4, and 5 with the equivalent HVRs from Ad43 was sufficient to avoid Ad5 preexisting immunity and retain full vaccine potential. However, the resulting vector displayed the same growth defect as the hexon-modified vector carrying all 9 HVRs from Ad43. The growth defect is likely due to a defect in capsid assembly, since DNA replication and late protein accumulation were normal in these vectors. We determined that the hexon-modified vectors have a 32°C cold-sensitive phenotype and selected revertants that restored vector productivity. Genome sequencing identified a single base change resulting in a threonine-to-methionine amino acid substitution at the position equivalent to residue 342 of the wild-type protein. This mutation has a suppressor phenotype (SP), since cloning it into our Ad5 vector containing all nine hypervariable regions from Ad43, Ad5.H(43m-43), increased yields over the version without the SP mutation. This growth improvement was also shown for an Ad5-based hexon-modified vector that carried the hexon hypervariable regions of Ad48, indicating that the SP mutation may have broad applicability for improving the productivity of different hexon-modified vectors.A denovirus vectors are considered a leading viral vector platform for vaccines because of their robust immunogenicity and manufacturing feasibility. The most potent adenovirus vectors for use as vaccines are based on adenovirus serotype 5 (Ad5) (1-6). Ad5 vectors can be grown to very high yields in bioreactors and can be purified efficiently with reasonable cost-of-goods estimates for vaccines. Adenovirus-based vectors are capable of generating robust and protective T cell and antibody responses in animal models (7)(8)(9)(10)(11)(12)(13)(14)(15)(16)(17), and clinical data conclusively show that Ad5 vectors can induce potent CD8 ϩ and CD4 ϩ T cell and antibody responses in vaccinated volunteers (18)(19)(20)(21)(22)(23)(24)(25). Most encouragingly, the protective capacity of a DNA prime-Ad5 boost regimen expressing two malaria antigens demonstrated sterile protection from malaria in 27% of test subjects (26). However, the high prevalence of Ad5-specific neutralizing antibodies (NAb) in human populations, especially in sub-Saharan Africa, has the potential to limit the effectiveness of Ad5-based vaccines (23,(27)(28)(29)(30).Hexon is the most abundant adenoviral structural protein, and studies show that it is the major target for NAb in vivo (23,31,32). These NAbs target the nine hypervariable regions that form the exposed ...

Interaction between hexon and L4-100K determines virus rescue and growth of hexon-chimeric recombinant Ad5 vectors

“…S4 ). For both Ad5-37(5, 7) and Ad5-43(5, 7), the level of genome replication and the expression of late adenovirus proteins were similar to that of Ad5 at all time points 20 . However, productivity of these vectors showed remarkable differences at all times compared to Ad5.…”

“…These results indicated the presence of other factors which could affect the hexon trimer formation. Thus far, several studies have reported the growth defect among chimeric adenovirus vectors 20 40 , and the authors posed the following reasons for these deficiencies in replication: 1) severe retardation of hexon folding into trimers which can delay the virus replication cycle; 2) antipathy of other major capsid proteins for the chimeric hexon, thereby causing stagnation of protein packing during virus assembly and production of progeny virus. However, the precise mechanism is still unclear.…”

Profiling the Targets of Protective CD8+ T Cell Responses to Infection

“…Cell lysates were serially passaged in this manner every 3 days until CPE was observed. The identity of the adenovector was determined using primers Ad5s278 (CGCGGGAAAACTGAATAAGA) and Ad5a3598 (GCTGCTGCAAAACAGATACA) as indicated in Figure 2 B. Vector yields were determined by using the ffu assay 60 on a subset of approximately 10% of the array to ensure that sufficient quantities of vector were being produced.…”

Development of Novel Adenoviral Vectors to Overcome Challenges Observed With HAdV-5–based Constructs

“… 58 , 101 Here, the identification of a single suppressor mutation in the hexon sequence that allowed for HAdV-5 vector HVR chimeras to be manufactured with near wild-type vector yields has fueled the generation of HVR chimeric vectors. 102 At present, a vaccine candidate against HIV, based on a HAdV-5 vector carrying the HVR domains from HAdV-48, has been shown to be both safe and immunogenic. 103 The i.v.…”