Identification of a Single Amino Acid Change in the Human Respiratory Syncytial Virus L Protein That Affects Transcriptional Termination

Inhibition of Na+ Transport in Lung Epithelial Cells by Respiratory Syncytial Virus Infection

“…After a hot start (3 min at 958C), 2.5 ml of each cDNA was subjected to 40 cycles of PCR (30 s each at T m 958C, T a 558C, T e 728C, per cycle) in 25 ml reaction volume on an Eppendorf Mastercycler (Eppendorf, Westbury, NY), using 100 pmol of primers specific for a 1,200-nt segment of the RSV L gene (a gift from Dr. Tara Cartee, Dept. of Microbiology, UAB) (23). The forward primer, GATTATATAG ATATCACATGGGTGGCATCG, corresponded to bases 10,800 to 10,829 and the reverse primer, CCTCATCATCTCAGTGGCTCTAT CAATATCTG, corresponded to the reverse complement of bases 11,976 to 12,007 in the A2 virus genome.…”

Phosphorylation of human respiratory syncytial virus P protein at threonine 108 controls its interaction with the M2-1 protein in the viral RNA polymerase complex

“…The P protein residue at position 105 is probably T (it cannot be replaced by A or D), whereas T108 can be replaced by A but not by D, suggesting that both residues are involved in contact with the M2-1 protein and that phosphorylation of P protein T108 prevents it. Phosphorylation at T108 would control P protein interaction with the M2-1 protein and, therefore, the M2-1 regulatory activity on the L protein during viral transcription (Cartee et al, 2003).Transiently expressed Long and A2 strain M2-1 proteins had an electrophoretic mobility lower than that of M2-1 protein from purified extracellular viral particles, due to their phosphorylation at T56 and S58 or at S58 and S61 (Cartee & Wertz, 2001) residues, respectively. Coexpression of M2-1 and P proteins leads to their interaction; the M2-1 protein is probably not phosphorylated in this interaction and its electrophoretic mobility increases (Cuesta et al, 2000).…”

“…The P protein residue at position 105 is probably T (it cannot be replaced by A or D), whereas T108 can be replaced by A but not by D, suggesting that both residues are involved in contact with the M2-1 protein and that phosphorylation of P protein T108 prevents it. Phosphorylation at T108 would control P protein interaction with the M2-1 protein and, therefore, the M2-1 regulatory activity on the L protein during viral transcription (Cartee et al, 2003).…”

“…Although we cannot exclude the possibility that P protein substitution T108D could abolish P-M2-1 interaction independently of mimicking phosphorylation, our results support that such interaction may be regulated by P protein T108 phosphorylation. As the M2-1 protein only influences L protein transcriptional activity (Cartee et al, 2003), P protein pT108 must be included in a vRdRp complex, unable to incorporate M2-1 protein and involved in viral RNA replication (vRdRpR, replicase). In contrast, when P protein is dephosphorylated at T108, the M2-1 protein, included in the vRdRp complex, is involved in efficient viral transcription (vRdRpT, transcriptase).…”

“…Lower panel: RNA fractionation in 3?5 % acrylamide gel containing 7 M urea. RNA was labelled with [ 3 H]uridine [25 mCi (925 kBq) ml "1 ] in the presence of 10 mg actinomycin D ml "1 between 16 and 48 h after transfection of HEp-2 cells (8610 5 cells per 35 mm 2 dish) with 1?9 mg pM/SH, together with 1?9 mg pGEM3N, 0?56 mg pL (except lane C) (Cartee et al, 2003), 0?1 mg pGEM3M2-1 and 0?77 mg pGEM3P (VP), or with the indicated VP recombinant variant plasmids. All pGEM3 recombinant plasmids contain HRSV Long strain sequences, except pM/SH and pL, which contain those of the A2 strain.…”