Identification of a Novel δ-Globin Gene Mutation in an Iranian Family

Abstract

δ-Thalassemia (δ-thal) has no clinical symptoms, but its coinheritance with β-thal may cause misdiagnosis, especially in countries with a high prevalence of β-thal where prevention programs have been implemented. The molecular basis of most β-thal syndromes have been defined, while the spectrum of mutations causing δ-thal have not been well characterized. A couple was referred to us for thalassemia molecular screening. Since she had rather low values of Hb A₂ and normal Hb F, her δ-globin gene was amplified and directly sequenced. We found two different mutations on her δ-globin genes: HBD: c.92+5G>T/HBD:c.428C>A. The c.92+5G>T mutation has not been previously reported. Two different mutations in trans may explain the reduced Hb A₂ level.

Molecular epidemiology, pathogenicity, and structural analysis of haemoglobin variants in the Yunnan province population of Southwestern China

“…Some Hb variants such as Hb E, Hb J-Bangkok, and Hb New York had no apparent clinical effects reported by previous report 22,26,28 . And individual of δ-globin gene defects usually has no clinically meaningful problems for low concentration of Hb A 2 regardless of the results of prediction 9,11 . But all of them were predicted to be “damaging” by SIFT and PolyPhen-2.…”

“…The polymerase chain reaction (PCR) reverse dot-blot (RDB) assay was used to detect αα CS (HBA2: c.427 T > C), αα QS (HBA2:c.377 T > C), and αα WS (HBA2:c.369 C > G) as previously reported 10 . The primers used and expected product size for β-globin 5 , α-globin 10 , and δ-globin 11 , are shown in Supplementary Table 1.…”

Analysis of deletional hereditary persistence of fetal hemoglobin/δβ‐thalassemia and δ‐globin gene mutations in Southerwestern China

“…Two fragments of the δ‐globin gene (NG_000007.3) were amplified using the following primers: δ1‐F 5′CTGAGTCAAGACACACATGACAG3′, δ1‐R 5′ TGGTATGCATAATTTGAGTTGTTG3′; δ2‐F 5′ AATATCCTGTCTTTCTCTCCCAAC3′, δ2‐R 5′ TAATTTCTGCTCTTTGGAGGTAG3′ (Amirian et al, ). Six of the following known α‐thalassemia deletions were analyzed as previously described (Zhang et al, ): ‐α 3.7 (NC_000016.9:g.223300_227103del), ‐α 4.2 (NC_000016.9:g.219817_(223755_224074)del), ‐‐ SEA (NC_000016.9:g.215400_234700del), α CS α (Hb Constant Spring, HBA2:c.427T > C), α WS α (Hb Weastmead, HBA2:c.369C > G), and α QS α (Hb Quong Sze, HBA2:c.377T > C).…”

In silico prediction of HBD gene variants in the Iranian population

“…However, to our knowledge, only a limited number of studies have been performed in Iran to identify the HBD gene variants. In fact, with the exception of the study by Kordafshari et al [23], which reported the spectrum of HBD gene variants in 21 individuals, other studies were case reports that identified a specific variant in one or a limited number of individuals [33][34][35]. Therefore, at least six different types of variants in the HBD gene were reported before in the Iranian population: Hb A2-Yialousa (HBD: c.82G>T), Hb A2-Coburg (HBD: c.350G>A), Hb A2-NYU (HBD: c.39 T>A), Hb A2-Etolia (HBD: c.257 T>C), Hb A2-Fitzroy (HBD: c.428C>A), and HBD: c.92+5G>T. The HBD: c.82G>T and HBD: c.92+5G>T variants were the most frequent ones among Iranian population [23,[33][34][35].…”