Identification of a Novel Streptococcal Gene Cassette Mediating SOS Mutagenesis in
            <i>Streptococcus uberis</i>

Varhimo, Emilia; Savijoki, Kirsi; Jalava, Jari; Kuipers, Oscar P.; Varmanen, Pekka

doi:10.1128/jb.00473-07

Cited by 30 publications

(56 citation statements)

References 70 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Our results confirmed that RecA performs an important function in mutagenesis, as shown by the rifampicin-and streptomycin-resistant fractions of wildtype and DrecA cultures. In the presence of RecA, rifampicin-resistant mutants arose with a frequency of 10 27 , which was similar to the frequencies that were reported in previous studies for L. monocytogenes (Boisivon et al, 1990), E. coli (Salmelin & Vilpo, 2002) and Streptococcus uberis (Varhimo et al, 2007). The frequency of rifampicin-resistant mutants in the DrecA mutant was 14-fold lower than in the wild-type strain.…”

Section: Discussionsupporting

confidence: 66%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologues, but their roles in Listeria have not been established. In this study, we identified the SOS regulon in L. monocytogenes by comparing the transcription profiles of a wild-type strain and a DrecA mutant strain after exposure to the DNAdamaging agent mitomycin C. In agreement with studies in other bacteria, we identified an imperfect palindrome AATAAGAACATATGTTCGTTT as the SOS operator sequence. The SOS regulon of L. monocytogenes consists of 29 genes in 16 LexA-regulated operons, encoding proteins with functions in translesion DNA synthesis and DNA repair. We furthermore identified a role for the product of the LexA-regulated gene yneA in cell elongation and inhibition of cell division. As anticipated, RecA of L. monocytogenes plays a role in mutagenesis; DrecA cultures showed considerably lower rifampicin-and streptomycin-resistant fractions than the wild-type cultures. The SOS response is activated after stress exposure as shown by recA-and yneApromoter reporter studies. Stress-survival studies showed DrecA mutant cells to be less resistant to heat, H 2 O 2 and acid exposure than wild-type cells. Our results indicate that the SOS response of L. monocytogenes contributes to survival upon exposure to a range of stresses, thereby likely contributing to its persistence in the environment and in the host.

show abstract

Section: Discussionsupporting

confidence: 66%

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

et al. 2010

View full text Add to dashboard Cite

show abstract

“…Indeed, a ⌬lexA(pVL3) strain overexpressing the mutated and uncleavable LexA A115D protein showed a significantly decreased rate of survival of exposure to ofloxacin and mitomycin C. However, the LexA-regulated pathway in S. mutans differs greatly from the canonical SOS response seen in other bacteria and even from other streptococcal species that have been identified with an SOS-like pathway via the LexA-like HdiR regulator. In S. thermophilus and S. uberis, HdiR functions similarly to LexA in regulating an SOSlike response by directly upregulating the expression of umuC upon DNA damage to bypass DNA lesions during DNA replication (44,45). However, the umuC gene and other genes with known or putative roles in DNA repair were not found to be regulated by LexA in S. mutans (see Table S2 in the supplemental material).…”

Section: Discussionmentioning

confidence: 88%

“…UmuC is a subunit of the error-prone DNA polymerase V found in bacteria and is involved in bypassing DNA lesions during DNA replication. In streptococci, this gene was found to be regulated by LexA-like repressors in Streptococcus thermophilus (44) and Streptococcus uberis (45). In S. mutans strain UA159, SMU.403 encodes a UmuC homolog exhibiting more than 85% amino acid sequence similarity to UmuC of S. thermophilus and S. uberis.…”

Section: Resultsmentioning

confidence: 99%

The Formation of Streptococcus mutans Persisters Induced by the Quorum-Sensing Peptide Pheromone Is Affected by the LexA Regulator

et al. 2015

View full text Add to dashboard Cite

bThe presence of multidrug-tolerant persister cells within microbial populations has been implicated in the resiliency of bacterial survival against antibiotic treatments and is a major contributing factor in chronic infections. The mechanisms by which these phenotypic variants are formed have been linked to stress response pathways in various bacterial species, but many of these mechanisms remain unclear. We have previously shown that in the cariogenic organism Streptococcus mutans, the quorumsensing peptide CSP (competence-stimulating peptide) pheromone was a stress-inducible alarmone that triggered an increased formation of multidrug-tolerant persisters. In this study, we characterized SMU.2027, a CSP-inducible gene encoding a LexA ortholog. We showed that in addition to exogenous CSP exposure, stressors, including heat shock, oxidative stress, and ofloxacin antibiotic, were capable of triggering expression of lexA in an autoregulatory manner akin to that of LexA-like transcriptional regulators. We demonstrated the role of LexA and its importance in regulating tolerance toward DNA damage in a noncanonical SOS mechanism. We showed its involvement and regulatory role in the formation of persisters induced by the CSP-ComDE quorum-sensing regulatory system. We further identified key genes involved in sugar and amino acid metabolism, the clustered regularly interspaced short palindromic repeat (CRISPR) system, and autolysin from transcriptomic analyses that contribute to the formation of quorum-sensing-induced persister cells.T he classical view of bacterial survival against antibiotic killing has usually been seen as the expression of genetic resistance mechanisms that arise from mutations or gained through horizontal gene transfer. These resistance mechanisms include host target modification, degradation or modification of the antibiotic itself, and reduction in the permeability or increase in the efflux of the drug (1). A major survival mechanism of bacteria is antibiotic tolerance, whereby bacterial cells that have a slower or reduced growth rate become more tolerant toward antibiotic killing (2, 3). This reduction in bacterial growth is prominently perceived as one of the main survival mechanisms elicited in bacterial biofilms, by which the slower growth of biofilm cells contributes toward the highly recalcitrant nature of biofilm infections, even in biofilm populations that lack genetically encoded antibiotic resistance markers (4, 5).Formation of persister cells is the main factor responsible for the tolerance of pathogens to antibiotics. Persisters are nongrowing dormant cells that are produced in a clonal population of genetically identical cells. They constitute a small fraction of the bacterial population. Persisters are not mutants but phenotypic variants of the wildtype population (6). In contrast to the case with the aforementioned drug resistance mechanisms, which allow for bacterial cells to actively grow and divide unimpeded in the presence of specific antimicrobials, persisters are capable of sur...

show abstract

“…Many opportunistic pathogens, including Legionella pneumophila, Streptococcus pneumoniae, and Helicobacter pylori (27)(28)(29), have noncanonical DNA damage responses (e.g., not mediated by a global LexA repressor).…”

mentioning

confidence: 99%

RNA-Mediated cis Regulation in Acinetobacter baumannii Modulates Stress-Induced Phenotypic Variation

et al. 2017

View full text Add to dashboard Cite

In the nosocomial opportunistic pathogen Acinetobacter baumannii, RecAdependent mutagenesis, which causes antibiotic resistance acquisition, is linked to the DNA damage response (DDR). Notably, unlike the Escherichia coli paradigm, recA and DDR gene expression in A. baumannii is bimodal. Namely, there is phenotypic variation upon DNA damage, which may provide a bet-hedging strategy for survival. Thus, understanding recA gene regulation is key to elucidate the yet unknown DDR regulation in A. baumannii. Here, we identify a structured 5= untranslated region (UTR) in the recA transcript which serves as a cis-regulatory element. We show that a predicted stem-loop structure in this 5= UTR affects mRNA half-life and underlies bimodal gene expression and thus phenotypic variation in response to ciprofloxacin treatment. We furthermore show that the stem-loop structure of the recA 5= UTR influences intracellular RecA protein levels and, in vivo, impairing the formation of the stem-loop structure of the recA 5= UTR lowers cell survival of UV treatment and decreases rifampin resistance acquisition from DNA damage-induced mutagenesis. We hypothesize that the 5= UTR allows for stable recA transcripts during stress, including antibiotic treatment, enabling cells to maintain suitable RecA levels for survival. This innovative strategy to regulate the DDR in A. baumannii may contribute to its success as a pathogen.IMPORTANCE Acinetobacter baumannii is an opportunistic pathogen quickly gaining antibiotic resistances. Mutagenesis and antibiotic resistance acquisition are linked to the DNA damage response (DDR). However, how the DDR is regulated in A. baumannii remains unknown, since unlike most bacteria, A. baumannii does not follow the regulation of the Escherichia coli paradigm. In this study, we have started to uncover the mechanisms regulating the novel A. baumannii DDR. We have found that a cisacting 5= UTR regulates recA transcript stability, RecA protein levels, and DNA damage-induced phenotypic variation. Though 5= UTRs are known to provide stability to transcripts in bacteria, this is the first example in which it regulates a bimodal DDR response through recA transcript stabilization, potentially enabling cells to have enough RecA for survival and genetic variability.KEYWORDS Acinetobacter, DNA damage, microbial genetics, RecA, gene expression, molecular biology A cinetobacter baumannii is a Gram-negative opportunistic pathogen that is a major problem in hospitals due to its ability to withstand desiccation (1), allowing it to ultimately reach immunocompromised individuals and cause diseases, including pneumonia and meningitis (2-4). Compounding this problem is the ability of A. baumannii to rapidly gain antibiotic resistances, such that there are now pan-resistant strains (5, 6). This may in part be due to A. baumannii's improved fitness during stress (7-10). However, fully understanding how A. baumannii rapidly acquires antibiotic resistances

show abstract

Identification of a Novel Streptococcal Gene Cassette Mediating SOS Mutagenesis in Streptococcus uberis

Cited by 30 publications

References 70 publications

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

The Formation of Streptococcus mutans Persisters Induced by the Quorum-Sensing Peptide Pheromone Is Affected by the LexA Regulator

RNA-Mediated cis Regulation in Acinetobacter baumannii Modulates Stress-Induced Phenotypic Variation

Contact Info

Product

Resources

About