Identification of a new Vrn-B1 allele using two near-isogenic wheat lines with difference in heading time

Shcherban, A. B.; Ефремова, Т. Т.; Салина, Е. А.

doi:10.1007/s11032-011-9581-y

Cited by 60 publications

(57 citation statements)

References 41 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…speltoides PCR markerNamePrimer (5’ → 3’)Target allele(s)Expected pro-duct size (bp)Annealing temp. (°C)Reference. VRN-A1 marker a Vrn1AFGAAAGGAAAAATTCTGCTCG VRN-A1f 65555[13]Int1RGCAGGAAATCGAAATCGAAG VRN-A1f-del VRN-A1f-ins VRN-A1f-del/ins VRN-A1 Non-deletionIntr1/C/FGCACTCCTAACCCACTAACC VRN-A1f 106856[14]Intr1/AB/RTCATCCATCATCAAGGCAAA VRN-A1f-ins VRN-A1 insertionIntr 1ATCATCTTCTCCACCAAGGG VRN-A1f 148050[15]Intr1insRAATGAACAGCACGGAAACAG VRN-A1f-ins 1910 VRN-A1f-del/ins mitefCAGGTAAGGTATGAGGTGAC VRN-A1f-ins 37052-miterGATTCCAAATGAGAAGATGAGG VRN-A1f-del/ins VRN-A1 deletion of 2.7 kbIntr1/A/F2AGCCTCCACGGTTTGAAAGTAA VRN-A1f-del ~250056[14]Intr4GCGCCATTAGGGAGGCACTT VRN-A1f-del/ins delfACATGTAAGCAGATCCTATCGA VRN-A1f-del 45053-delrTGCTTTAGATCTTTCTTCACGG VRN-A1f-del/ins VRN-G1 marker a for T. araraticum /P1TACCCCTGCTACCAGTGCCT VRN-G1 90055[23] T. timopheevii P5GGCCAACCCTACACCCCAAG VRN-G1a 1100for Ae. speltoides P8CTAGGACTGGCGAGTATCTT VRN-1 90055-P10GAGAACCGGGCCAACCCTAC VRN-G1 Non-deletion...…”

Section: Resultsmentioning

confidence: 99%

“…It was suggested that all these mutations may affect epigenetic chromatin states, resulting in a higher basal level of VRN-1 expression which is necessary for inducing a spring type of growth [22, 30]. Previously, we described the dominant allele VRN-B1c as having large alterations (deletion and duplication) within the 5’-flanking part of intron 1 and found that these mutations resulted in a higher level of VRN-1 transcription and subsequent reduction in flowering time compared to the allele without such mutations [23, 24]. Another example is the VRN-A1ins allele of the diploid T. monococcum (AA) with a 0.5 kb insertion in the same region which is associated with a spring growth habit in 30 % accessions of this species [15, 21].…”

Section: Discussionmentioning

confidence: 99%

“…PCR primers reported in [13, 14, 23, 24] were used to identify different alleles of VRN-A1 and VRN-G1 loci in the material studied (Table 1; Fig. 1).…”

Section: Methodsmentioning

confidence: 99%

See 2 more Smart Citations

The occurrence of spring forms in tetraploid Timopheevi wheat is associated with variation in the first intron of the VRN-A1 gene

2016

View full text Add to dashboard Cite

Background Triticum araraticum and Triticum timopheevii are tetraploid species of the Timopheevi group. The former includes both winter and spring forms with a predominance of winter forms, whereas T. timopheevii is considered a spring species. In order to clarify the origin of the spring growth habit in T. timopheevii, allelic variability of the VRN-1 gene was investigated in a set of accessions of both tetraploid species, together with the diploid species Ae. speltoides, presumed donor of the G genome to these tetraploids.ResultsThe promoter region of the VRN-A1 locus in all studied tetraploid accessions of both T. araraticum and T. timopheevii represents the previously described allele VRN-A1f with a 50 bp deletion near the start codon. Three additional alleles were identified namely, VRN-A1f-del, VRN-A1f-ins and VRN-A1f-del/ins, which contained large mutations in the first (1st) intron of VRN-A1. The first allele, carrying a deletion of 2.7 kb in a central part of intron 1, occurred in a few accessions of T. araraticum and no accessions of T. timopheevii. The VRN-A1f-ins allele, containing the insertion of a 0.4 kb MITE element about 0.4 kb upstream from the start of intron 1, and allele VRN-A1f-del/ins having this insertion coupled with a deletion of 2.7 kb are characteristic only for T. timopheevii. Allelic variation at the VRN-G1 locus includes the previously described allele VRN-G1a (with the insertion of a 0.2 kb MITE in the promoter) found in a few accessions of both tetraploid species. We showed that alleles VRN-A1f-del and VRN-G1a have no association with the spring growth habit, while in all accessions of T. timopheevii this habit was associated with the dominant VRN-A1f-ins and VRN-A1f-del/ins alleles. None of the Ae. speltoides accessions included in this study had changes in the promoter or 1st intron regions of VRN-1 which might confer a spring growth habit. The VRN-1 promoter sequences analyzed herein and downloaded from databases have been used to construct a phylogram to assess the time of divergence of Ae. speltoides in relation to other wheat species.ConclusionsAmong accessions of T. araraticum, the preferentially winter predecessor of T. timopheevii, two large mutations were found in both VRN-A1 and VRN-G1 loci (VRN-A1f-del and VRN-G1a) that were found to have no effect on vernalization requirements. Spring tetraploid T. timopheevii had one VRN-1 allele in common for two species (VRN-G1a), and two that were specific (VRN-A1f-ins, VRN-A1f-del/ins). The latter alleles include mutations in the 1st intron of VRN-A1 and also share a 0.4 kb MITE insertion near the start of intron 1. We suggested that this insertion resulted in a spring growth habit in a progenitor of T. timopheevii which has probably been selected during subsequent domestication. The phylogram constructed on the basis of the VRN-1 promoter sequences confirmed the early divergence (~3.5 MYA) of the ancestor(s) of the B/G genomes from Ae. speltoides.Electronic supplementary materialThe online version of this article (doi:10.1186/s1...

show abstract

Section: Resultsmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

The occurrence of spring forms in tetraploid Timopheevi wheat is associated with variation in the first intron of the VRN-A1 gene

2016

View full text Add to dashboard Cite

show abstract

“…Vrn-A1b allelic variants and Vrn-A1f allele have mutations and deletions of variable lengths in the promoter region, whereas Vrn-A1c has a deletion in the first intron in comparison to the recessive vrn-A1 allele [16, 19, 20, 22, 23]. Most of the dominant alleles of VRN-B1 and VRN-D1 genes possess deletions in the first intron ( Vrn-B1a , Vrn-B1b , Vrn-B1c and Vrn-D1a ) [16, 19, 22, 24–27]. Several recently identified alleles ( Vrn-B1ins, Vrn-D1c, Vrn-D1s ) are characterized by different insertions within the promoter region [19, 28, 29].…”

Section: Introductionmentioning

confidence: 99%

VRN1 genes variability in tetraploid wheat species with a spring growth habit

et al. 2016

View full text Add to dashboard Cite

BackgroundVernalization genes VRN1 play a major role in the transition from vegetative to reproductive growth in wheat. In di-, tetra- and hexaploid wheats the presence of a dominant allele of at least one VRN1 gene homologue (Vrn-A1, Vrn-B1, Vrn-G1 or Vrn-D1) determines the spring growth habit. Allelic variation between the Vrn-1 and vrn-1 alleles relies on mutations in the promoter region or the first intron. The origin and variability of the dominant VRN1 alleles, determining the spring growth habit in tetraploid wheat species have been poorly studied.ResultsHere we analyzed the growth habit of 228 tetraploid wheat species accessions and 25 % of them were spring type. We analyzed the promoter and first intron regions of VRN1 genes in 57 spring accessions of tetraploid wheats. The spring growth habit of most studied spring accessions was determined by previously identified dominant alleles of VRN1 genes. Genetic experiments proof the dominant inheritance of Vrn-A1d allele which was widely distributed across the accessions of Triticum dicoccoides. Two novel alleles were discovered and designated as Vrn-A1b.7 and Vrn-B1dic. Vrn-A1b.7 had deletions of 20 bp located 137 bp upstream of the start codon and mutations within the VRN-box when compared to the recessive allele of vrn-A1. So far the Vrn-A1d allele was identified only in spring accessions of the T. dicoccoides and T. turgidum species. Vrn-B1dic was identified in T. dicoccoides IG46225 and had 11 % sequence dissimilarity in comparison to the promoter of vrn-B1. The presence of Vrn-A1b.7 and Vrn-B1dic alleles is a predicted cause of the spring growth habit of studied accessions of tetraploid species. Three spring accessions T. aethiopicum K-19059, T. turanicum K-31693 and T. turgidum cv. Blancal possess recessive alleles of both VRN-A1 and VRN-B1 genes. Further investigations are required to determine the source of spring growth habit of these accessions.ConclusionsNew allelic variants of the VRN-A1 and VRN-B1 genes were identified in spring accessions of tetraploid wheats. The origin and evolution of VRN-A1 alleles in di- and tetraploid wheat species was discussed.Electronic supplementary materialThe online version of this article (doi:10.1186/s12870-016-0924-z) contains supplementary material, which is available to authorized users.

show abstract

“…This spring allele has been transferred, and is now also present in triticale genotypes, however we did not show the influence of this allele on flowering time. Lately few more Vrn-B1 alleles have been described in wheat (Milec et al, 2012;Shcherban et al, 2012). Their presence can be a source of allelic variation of VRN-1 in the triticale genome as well.…”

Section: Discussionmentioning

confidence: 99%

Analysis of VRN1 gene in triticale and common wheat genetic background

Nowak

Leśniowska-Nowak

Zapalska

et al. 2014

Sci. agric. (Piracicaba, Braz.)

View full text Add to dashboard Cite

In cereals, the transition from the vegetative stage to flowering is controlled in the main by the set of vernalization genes. Within these genes the most important role is played by VRN1, which encodes a MADS-box transcription factor, regulating the transition of shoot apical meristem to the reproductive phase. The level of vernalization requirement is strongly linked to the molecular structure of this gene. In this study we analyzed molecular mechanisms regulating the vernalization requirement in triticale on the basis of comparative analysis of the VRN1 locus between triticale (×Triticosecale Witt.) and common wheat (Triticum aestivum L.) genotypes. We also estimated the influence of VRN genotype on heading time and the winter hardiness of these two species. Molecular markers developed for VRN genotype detection in common wheat were successfully applied to an analysis of triticale genomic DNA. Subsequent analysis of the amplicons nucleotide sequence confirmed full similarity of the products obtained between triticale and common wheat. All winter triticale cultivars tested contained the recessive vrn-A1 allele, whereas all spring genotypes carried the dominant Vrn-A1a allele. Molecular analysis of the Vrn-B1 gene revealed the presence of the dominant Vrn-B1b allele in only one of the triticale genotypes analyzed (Legalo). The major system of determination of the vernalization requirement in triticale was transferred from common wheat without changes and is based on an alteration in the VRN1 gene promoter sequence within the A genome.

show abstract

Identification of a new Vrn-B1 allele using two near-isogenic wheat lines with difference in heading time

Cited by 60 publications

References 41 publications

The occurrence of spring forms in tetraploid Timopheevi wheat is associated with variation in the first intron of the VRN-A1 gene

The occurrence of spring forms in tetraploid Timopheevi wheat is associated with variation in the first intron of the VRN-A1 gene

VRN1 genes variability in tetraploid wheat species with a spring growth habit

Analysis of VRN1 gene in triticale and common wheat genetic background

Contact Info

Product

Resources

About