Identification keys to halosaurs and notacanthids (Notacanthiformes, Elopomorpha) in the subarctic Atlantic Ocean including three new distributional records and multiple molecular OTUs of Notacanthus cf. chemnitzii

Poulsen, Jan Yde; Thorkildsen, Solveig; Arboe, Nanette Hammeken

doi:10.1007/s12526-017-0762-8

Cited by 10 publications

(18 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…No other specimens of S. schnakenbecki tissue samples were available. The two specimens and many other alepocephaliform taxa were barcoded as part of the Greenland fishes (GLF) barcoding project (Poulsen et al ., ). Total DNA extraction was performed using the DNeasy Blood & Tissue kit (Qiagen; http://www.qiagen.com).…”

Section: Methodsmentioning

confidence: 97%

“…Total DNA extraction was performed using the DNeasy Blood & Tissue kit (Qiagen; http://www.qiagen.com). Primers used for the coI barcode were forward FishF2 (5′‐TCGACTAATCATAAAGATATCGG CAC‐3′) and reverse FishR2 (5′‐ACTTCAGGGTGACCGAAGAATCAGAA‐3′) (Ward et al ., ) with the PCR performed according to standard thermocycle protocols (Poulsen et al ., ). PCR products were UV‐visualized on 1% agarose gels stained with gel red or ethidium bromide and subsequently purified using EXO‐SAP (Thermo Fisher Scientific; http://www.thermofisher.com).…”

Section: Methodsmentioning

confidence: 97%

See 1 more Smart Citation

New observations and ontogenetic transformation of photogenic tissues in the tubeshoulder Sagamichthys schnakenbecki (Platytroctidae, Alepocephaliformes)

Poulsen

2018

Journal of Fish Biology

Self Cite

View full text Add to dashboard Cite

Funding informationThis research received no specific grant from any funding agency, commercial or not-forprofit sectors (part of a continuous effort to monitor fish biodiversity off Greenland and construct taxonomic identification material).Several species of the luminescent tubeshoulder fish (family Platytroctidae) show extensive ontogenetic transformations in the development of bioluminescent structures from larvae to adults. Several types of luminescent tissues are present in platytroctids, although these tissues are poorly known for most species because specimens are rarely observed. The present study describes the ontogenetic transformation of photogenic structures in Sagamichthys schnakenbecki, a species that is found in meso and bathy-pelagic depths of the Atlantic Ocean. Five newly described luminous structures are included in addition to a review of all known bioluminescent tissues described in the family. The newly discovered photogenic tissues were observed at the pectoral-fin base in early juveniles, as a pair of large globule-like tissues inside the caudal peduncle of early juveniles, at the pelvic girdle of late juveniles and early adults and as photogenic tissue observed as pigment over the cleithral bone in adults. A peculiar skin-slit structure, which was observed only in S. schnakenbecki, is described and discussed. Skin slits were associated with certain bioluminescent structures during the transformation into adulthood. In addition, coI sequence data from nine of 13 recognized platytroctid genera were used to construct the first molecular phylogenetic tree for the family. Finally, the first photographic evidence of the rarely observed luminous discharge of a tubeshoulder shoulder organ is presented from observations off south-east Greenland. K E Y W O R D Sbarcoding, bioluminescence, ontogeny, shoulder organ, skin slits, tubeshoulder

show abstract

Section: Methodsmentioning

confidence: 97%

Section: Methodsmentioning

confidence: 97%

New observations and ontogenetic transformation of photogenic tissues in the tubeshoulder Sagamichthys schnakenbecki (Platytroctidae, Alepocephaliformes)

Poulsen

2018

Journal of Fish Biology

Self Cite

View full text Add to dashboard Cite

show abstract

“…The new record off Greenland of Gadiculus thori (ZMUB 14683) was Cytochrome Oxidase 1 (Cox1) barcoded as part of the Greenland Fishes (GLF) barcoding project [24] and the sequence deposited in the BOLD repository [25] as GLF136. Additional materials included for molecular comparisons were either newly generated (20 specimens) as part of the GLF project (see [24] for laboratory works) or downloaded (76 specimens) from BOLD.…”

Section: Molecular Analysesmentioning

confidence: 99%

“…Additional materials included for molecular comparisons were either newly generated (20 specimens) as part of the GLF project (see [24] for laboratory works) or downloaded (76 specimens) from BOLD. We calculated uncorrected distances for the two taxa including the smallest interspecific distance (barcoding gap) that potentially indicates species delimitation based on Cox1 DNA sequences (Meier and Paulay [26] and Meier et al, 2008 [27]).…”

Section: Molecular Analysesmentioning

confidence: 99%

“…Poulsen, personal observation). The Greenland-Iceland submarine ridge could potentially facilitate distribution of shelf-associated species such as G. thori [24]. Distributional changes for pelagic fishes are a complicated matter in subarctic Atlantic waters, as yearly seawater temperature changes are heterogeneously occurring at various depths [67].…”

Section: Present Geographic Distributionsmentioning

confidence: 99%

See 1 more Smart Citation

Recognition and Distribution of Two North Atlantic Gadiculus Species, G. argenteus and G. thori (Gadidae), Based on Otolith Morphology, Larval Pigmentation, Molecular Evidence, Morphometrics and Meristics

Gaemers

Poulsen

2017

Fishes

Self Cite

View full text Add to dashboard Cite

Abstract:The silvery pout genus Gadiculus consists of small aberrant codfishes with several extinct and currently only one recognized extant species. The oldest representatives of a Gadiculus lineage known from otoliths are Early Miocene in age. Fossil evidence has showed Gadiculus to originate from older genera diverging early from other true cods of the family Gadidae. As adult specimens of different species have been found to be highly similar and difficult to distinguish based on meristic and morphometric data, the number of species in this gadid genus has been controversial since different larval morphotypes were first discovered some 100 years ago. For almost 70 years, Gadiculus thori and Gadiculus argenteus have been considered subspecies only, with a distribution in the Northeast Atlantic Ocean including the Mediterranean. In this study, we resolve the long-standing issue of extant Gadiculus not being monotypic. New results in the form of distinct adult otoliths and molecular data unambiguously show two species of Gadiculus present-in agreement with larval morphotypes. Morphometric, meristic and molecular characters, as well as larval pigmentation are discussed in addition to present and past geographic distributions of the two taxa from distributions of fossil otoliths. At present, the cold-water species Gadiculus thori (northern silvery pout) is distributed in cold-temperate and subarctic latitudes in the Northeast Atlantic, including a new range extension off Southeast Greenland. Gadiculus argenteus (southern silvery pout) occurs in warmer waters and is distributed in the warm-temperate East Atlantic and Mediterranean. Fossil otoliths show that both species often co-existed in the Mediterranean from the Late Pliocene to the Middle Pleistocene.

show abstract

Phylogenetic analysis shows the general diversification pattern of deep-sea notacanthiforms (Teleostei: Elopomorpha)

Barros-García

Froufe²,

Bañón

et al. 2018

Molecular Phylogenetics and Evolution

View full text Add to dashboard Cite

The Notacanthiformes is an ancient group of deep-sea ray-finned fishes comprising 27 species in two families; Halosauridae and Notacanthidae. Although many studies have tried to reconstruct the phylogenetic relationships among the major clades of Elopomorpha, little is known about the evolutionary history of notacanthiforms. Molecular and morphological data were used to test previous hypotheses regarding the phylogenetic relationships among notacanthiform taxa, and to unravel the origin and evolution of this group. The molecular analyses of notacanthids showed similar results to those previously obtained employing osteological data, which proposed the existence of the Lipogenyinae (Lipogenys) and Notacanthinae (Notacanthus + Polyacanthonotus) subfamilies. Nevertheless, when the external morphology data is considered Lipogenys is more related to Notacanthus than Polyacanthonotus. The analyses could not fully resolve the inner relationships of the halosaurids. The time-calibrated tree of the order Notacanthiformes shows a long process of diversification spanning from the upper Cretaceous, to 50 million years after the K-Pg extinction, with the gradual emergence of all the modern families and genera of the group. This is the first specific phylogeny of the order Notacanthiformes, combining different analyses and data in order to obtain a wider perspective of the evolution and diversification of this group of fishes.

show abstract

Identification keys to halosaurs and notacanthids (Notacanthiformes, Elopomorpha) in the subarctic Atlantic Ocean including three new distributional records and multiple molecular OTUs of Notacanthus cf. chemnitzii

Cited by 10 publications

References 49 publications

New observations and ontogenetic transformation of photogenic tissues in the tubeshoulder Sagamichthys schnakenbecki (Platytroctidae, Alepocephaliformes)

New observations and ontogenetic transformation of photogenic tissues in the tubeshoulder Sagamichthys schnakenbecki (Platytroctidae, Alepocephaliformes)

Recognition and Distribution of Two North Atlantic Gadiculus Species, G. argenteus and G. thori (Gadidae), Based on Otolith Morphology, Larval Pigmentation, Molecular Evidence, Morphometrics and Meristics

Phylogenetic analysis shows the general diversification pattern of deep-sea notacanthiforms (Teleostei: Elopomorpha)

Contact Info

Product

Resources

About