Identification and Mutational Analysis ofrfbG,the Gene Encoding CDP-D-Glucose-4,6-Dehydratase, Isolated from Free Living Soil BacteriumAzotobacter vinelandii

Gavini, Nara; Hausman, Bryan S.; Pulakat, Lakshmi; Schreiner, Ryan; Williamson, Jeffrey A.

doi:10.1006/bbrc.1997.7545

Cited by 14 publications

(10 citation statements)

References 37 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…In Azotobacter vinelandii , disruption of this gene has been shown to result in a drastic reduction of growth rate (Gavini et al . ). ERIC1_3c0050 encodes for another sMC protein, as mentioned earlier these class of condensines are known to play a role in virulence due to attenuated growth (Zhao et al .…”

Section: Discussionmentioning

confidence: 97%

Unbiased random mutagenesis contributes to a better understanding of the virulent behaviour ofPaenibacillus larvae

et al. 2017

View full text Add to dashboard Cite

Aims: American foulbrood, caused by the Gram-positive bacteria Paenibacillus larvae, is one of the most severe bacterial diseases of the European honey bee. The bacterium has been known for long, but only the last decade the mechanisms used by the pathogen to cause disease in its host are starting to unravel. In this study, the knowledge of this virulent behaviour is expanded and several possible virulence factors are suggested. Methods and Results: Identification of possible virulence factors has been done by random mutagenesis to ensure an unbiased approach. A library of mutants was tested for a significant difference in virulence using in vitro exposure assays. Affected loci were characterized and their potential to contribute in virulence of the pathogen was assessed. Conclusions: The identified mutated loci dacB, dnaK, metN, ywqD, lysC, serC and gbpA are known to encode for virulence factors in other bacteria and are suggested to play a similar role in P. larvae. Significance and Impact of the Study: The study identified new possible virulence factors for P. larvae genotype ERIC I in an unbiased way. This contributes to the knowledge and understanding of the possible mechanisms used by this pathogen to colonize and kill its host.

show abstract

Section: Discussionmentioning

confidence: 97%

Unbiased random mutagenesis contributes to a better understanding of the virulent behaviour ofPaenibacillus larvae

et al. 2017

View full text Add to dashboard Cite

show abstract

“…In stark contrast to the physical approaches, several genetic approaches yielded results that indicated that A. vinelandii is not polyploid [Bishop and Premakumar, 1992;Gavini and Burgess, 1992;Gavini et al, 1997;Maldonado et al, 1992;Pulakat et al, 1996Pulakat et al, , 1998]. Main arguments were the ability to isolate mutants carrying recessive mutations, the segregation pattern of mutations, and the instability of heterozygous transconjugants, which segregated into stable homozygous lines in the absence of selection.…”

Section: A Vinelandii: Polyploidy As a Laboratory Artifact?mentioning

confidence: 99%

Polyploidy in Archaea and Bacteria: About Desiccation Resistance, Giant Cell Size, Long-Term Survival, Enforcement by a Eukaryotic Host and Additional Aspects

Soppa¹

2014

Microb Physiol

102

View full text Add to dashboard Cite

During recent years, it has become clear that many species of archaea and bacteria are polyploid and contain more than 10 copies of their chromosome. In this contribution, eight examples are discussed to highlight different aspects of polyploidy in prokaryotes. The species discussed are the bacteria Azotobacter vinelandii, Deinococcus radiodurans, Sinorhizobium meliloti, and Epulopiscium as well as the archaea Methanocaldococcus jannaschii, Methanococcus maripaludis, Haloferax volcanii, and haloarchaeal isolates from salt deposits. The topics include possible laboratory artifacts, resistance against double-strand breaks, long-term survival, relaxation of DNA segregation and septum formation, enforced polyploidy by a eukaryotic host, genome equalization by gene conversion, and the nongenetic usage of genomic DNA as a phosphate storage polymer. Together, the selected topics give an overview of the biodiversity of polyploidy in archaea and bacteria.

show abstract

“…The primers used for PCR amplifying the nifH were 5′‐GATATCATGCGTCAATGCGCCATCTACGGC‐3′ and 5′‐GGATCCT CAGACTTCGGCGGTTTTGCCGACGATGG‐3′; for nifD were 5′‐GACCGGTATGTCG CGCGAAGAGGTTGAAT‐3′ and 5′‐TCAGGCGCTGGCGGCGACTTTCTCGGCGCCTT‐3′; and for nifK were 5′‐GAGCCAGCAAGTCGATAAAATCAAAGCCAG‐3′ and 5′‐AGCGTACCA GGTCGTGGTTGTAGTCGGT‐3′. The DNA fragments encoding the nifH , nifD or nifK from A. vinelandii BG9 (generated by PCR amplification) were used to transform the A. vinelandii UW97 [45,46]. Since the DNA fragments encoding the nif ‐structural genes share homology with the chromosome it was expected that they would undergo recombination with their counterparts present on the chromosome [46].…”

Section: Resultsmentioning

confidence: 99%

“…To construct A. vinelandii strains that contained site‐directed mutations in the nifH gene, a gene replacement technique previously described in detail was used [45,46]. A. vinelandii strains have a very efficient recombination system that allows homologous recombination between the newly delivered sequence and the host chromosome.…”

Section: Methodsmentioning

confidence: 99%

Identification of a second site compensatory mutation in the Fe‐protein that allows diazotrophic growth of Azotobacter vinelandii UW97

et al. 2000

Self Cite

View full text Add to dashboard Cite

show abstract

Identification and Mutational Analysis ofrfbG,the Gene Encoding CDP-D-Glucose-4,6-Dehydratase, Isolated from Free Living Soil BacteriumAzotobacter vinelandii

Cited by 14 publications

References 37 publications

Unbiased random mutagenesis contributes to a better understanding of the virulent behaviour ofPaenibacillus larvae

Unbiased random mutagenesis contributes to a better understanding of the virulent behaviour ofPaenibacillus larvae

Polyploidy in Archaea and Bacteria: About Desiccation Resistance, Giant Cell Size, Long-Term Survival, Enforcement by a Eukaryotic Host and Additional Aspects

Identification of a second site compensatory mutation in the Fe‐protein that allows diazotrophic growth of Azotobacter vinelandii UW97

Contact Info

Product

Resources

About