Identification and Expression of Cephamycinase bla _CMY Genes in Escherichia coli and Salmonella Isolates from Food Animals and Ground Meat

Abstract

Twenty-one Salmonella and 54 Escherichia coli isolates, recovered from food animals and retail ground meats, that exhibited decreased susceptibilities to ceftiofur and ceftriaxone were shown to possess a bla CMY gene. The bla CMY-4 gene was identified in an E. coli isolate recovered from retail chicken and was further shown to be responsible for resistance to cephalothin, ampicillin, and amoxicillin-clavulanic acid and elevated MICs of ceftriaxone, cefoxitin, and ceftiofur.

Characterization of class 1 integrons and antibiotic resistance genes in multidrug-resistant Salmonella enterica isolates from foodstuff and related sources

“…The lack of expression of these genes suggests that besides environment and genotype, gene expression is dependent upon upstream promoter (28). On the other hand, some isolates were resistant to chloramphenicol but no flo st could be detected.…”

Emergence of Salmonella epidemics: The problems related to Salmonella enterica serotyp Enteritidis and multiple antibiotic resistance in other major serotypes

“…In 2000, the emergence of domestically acquired infections by E-S cephalosporin-resistant Salmonella carrying a plasmid-mediated CMY-2 AmpC β-lactamase was reported by the National Antimicrobial Resistance Monitoring System (NARMS) in the USA [47]. Molecular and phenotypic analysis of E-S cephalosporin-resistant strains revealed several distinct serotypes and chromosomal DNA patterns, suggesting that this resistance phenotype is present among genetically diverse strains [47,158]. It has been recently demonstrated that the bla CMY genes in Salmonella reside on different large plasmids [26].…”

Effect of cefovecin on the fecal flora of healthy dogs

“…PCR amplification (denaturation for 30 seconds at 95 °C, primer annealing for 30 seconds at 55 °C, and extension for 30 seconds at 72 °C) consistently yields a product size of 101 bp and has been successfully used in DNA from pure cultures or total fecal DNA (Zhao et al, 2001). …”

“…The bla CMY-2 gene was amplified using forward primer 5 1 GACAGCCTCTTTCTCCACA (reference number 59972060), and reverse primer 5 1 GAATAGCCTGCTCCTGCATC (reference number 59972061) (Zhao et al, 2001). PCR amplification (denaturation for 30 seconds at 95 °C, primer annealing for 30 seconds at 55 °C, and extension for 30 seconds at 72 °C) consistently yields a product size of 101 bp and has been successfully used in DNA from pure cultures or total fecal DNA (Zhao et al, 2001).…”