Identification and expression analysis of ERF transcription factor genes in petunia during flower senescence and in response to hormone treatments

Abstract

Ethylene-responsive element-binding factor (ERF) genes constitute one of the largest transcription factor gene families in plants. In Arabidopsis and rice, only a few ERF genes have been characterized so far. Flower senescence is associated with increased ethylene production in many flowers. However, the characterization of ERF genes in flower senescence has not been reported. In this study, 13 ERF cDNAs were cloned from petunia. Based on the sequence characterization, these PhERFs could be classified into four of the 12 known ERF families. Their predicted amino acid sequences exhibited similarities to ERFs from other plant species. Expression analyses of PhERF mRNAs were performed in corollas and gynoecia of petunia flower. The 13 PhERF genes displayed differential expression patterns and levels during natural flower senescence. Exogenous ethylene accelerates the transcription of the various PhERF genes, and silver thiosulphate (STS) decreased the transcription of several PhERF genes in corollas and gynoecia. PhERF genes of group VII showed a strong association with the rise in ethylene production in both petals and gynoecia, and might be associated particularly with flower senescence in petunia. The effect of sugar, methyl jasmonate, and the plant hormones abscisic acid, salicylic acid, and 6-benzyladenine in regulating the different PhERF transcripts was investigated. Functional nuclear localization signal analyses of two PhERF proteins (PhERF2 and PhERF3) were carried out using fluorescence microscopy. These results supported a role for petunia PhERF genes in transcriptional regulation of petunia flower senescence processes.

Molecular Characterization and Functional Analysis of Two Petunia PhEILs

“…RNA extraction and RT-PCR was performed according to the previous protocols (Liu et al, 2010). The RNA content was determined spectrophotometrically.…”

“…The remaining 5′ and 3′ cDNA sequences of PhEIL2 were cloned by rapid-amplification of cDNA ends (RACE) with the forward primer 5′CTATCCTGATCGCTGCCCACCT3′ and revered primer 5′TCTCCAATGGAAATCTTCTCTG3′ (Liu et al, 2010). …”

“…To measure ethylene production, corollas of each individual flower were collected and placed in a 200 ml airtight container according to the method of Liu et al (2010). Thus, to avoid the contamination of wound-induced ethylene, the containers were capped and incubated at 25°C for 1 h. Next, a 2 ml sample of head-space gas was withdrawn using a gas-tight hypodermic syringe and was injected into a gas chromatograph (GC 17A, Shimadzu, Kyoto, Japan) to measure the ethylene concentration.…”

Flower senescence: some molecular aspects

“…A number of ERF genes have been identified (as listed in Table 7) and classified into small groups on the basis of structural similarities, e.g., 12 groups (group I-X, vI-L and Xb-L) in Arabidopsis (Nakano et al 2006). Similarly, Liu et al (2011) has also characterized and classified the 13 eRFs from Petunia (PhERF1-PhERF13). Of the 13 ERFs, PhERF2 and PhERF3 have been shown to be associated with flower senescence.…”

Isolation and Characterization of the Iron-Regulated MxbHLH01 Gene in Malus xiaojinensis

“…Transcription factors play important roles in stress survival by serving as master regulators of sets of downstream stress-responsive genes. Important families of transcription factors include ethylene-responsive element-binding factor (Liu et al 2011), dehydration-responsive element binding (Wang et al 2010), and basic helix-loop-helix (bHLH) transcription factors (Meng et al 2009), among others.…”