Identification and Differential Expression of MicroRNAs during Metamorphosis of the Japanese Flounder (Paralichthys olivaceus)

Abstract

BackgroundMicroRNAs (miRNAs) are a class of endogenous small non-coding RNAs of 20–25 nucleotides that play a key role in diverse biological processes. Japanese flounder undergo dramatic metamorphosis in their early development. The metamorphosis is characterized by morphological transformation from a bilaterally symmetrical to an asymmetrical body shape concomitant with extensive morphological and physiological remodeling of organs. So far, only a few miRNAs have been identified in fish and there are very few reports about the Japanese flounder miRNA.Methodology/Principal FindingsSolexa sequencing technology was used to perform high throughput sequencing of the small RNA library from the metamorphic period of Japanese flounder. Subsequently, aligning these sequencing data with metazoan known miRNAs, we characterized 140 conserved miRNAs and 57 miRNA: miRNA* pairs from the small RNA library. Among these 57 miRNA: miRNA* pairs, twenty flounder miRNA precursors were amplified from genomic DNA. We also demonstrated evolutionary conservation of Japanese flounder miRNAs and miRNA* in the animal evolution process. Using miRNA microarrays, we identified 66 differentially expressed miRNAs at two metamorphic stages (17 and 29 days post hatching) of Japanese flounder. The results show that miRNAs might play a key role in regulating gene expression during Japanese flounder metamorphosis.Conclusions/SignificanceWe identified a large number of miRNAs during flounder metamorphosis, some of which are differentially expressed at two different metamorphic stages. The study provides an opportunity for further understanding of miRNA function in the regulation of flounder metamorphosis and gives us clues for further studies of the mechanisms of metamorphosis in Japanese flounder.

Characterization of microRNAs from goat (Capra hircus) by Solexa deep-sequencing technology

“…Fu et al (2011) agreed with the viewpoint that this result was caused by the scarcity of goat EST information in GenBank. If the goat genome sequence information were being constantly improved, we could take advantage of the genomic information to research the goat miRNAs, which makes the obtained results much richer and perfect.…”

PAPD5-mediated 3′ adenylation and subsequent degradation of miR-21 is disrupted in proliferative disease

“…For human, the mature miR-21 sequence listed in miRBase (30) is the common 22-nt isoform UAGCUUAU-CAGACUGAUGUUGA. This 22-nt sequence and its 3′ downstream sequence are conserved in all species we analyzed, except for Japanese flounder (52), for which the mature sequence is UAGCUUAUCAGACUGGUGUUGG but the downstream sequence is the same as for the other species.…”

Identification of conserved microRNAs and their target genes in Nile tilapia (Oreochromis niloticus) by bioinformatic analysis

“…Additionally, 80 bp of bilateral flanking sequences from the candidate miRNAs in the ESTs and GSS were extracted and their secondary structures were predicted using the webbased Mfold 3.1 software (http://www.bioinfo.rpi.edu/applications/mfold/) (Zuker, 2003). A sequence was considered to be a candidate miRNA precursor if the hairpin structure satisfied the criteria described by Fu et al (2011): 1) the minimum free energy (DG) is ≤ -15 kcal/mol; 2) the stem region includes at least 80% mature miRNA; 3) the number of allowed errors in 1 bulge is ≤18 bp; 4) the hairpin is >53 bp long; 5) the loop region is <22 bp; and 6) the number of mismatches between the miRNA and the anti-stem sequence is ≤6 bp.…”