Identification and characterization of the zebrafish ClC-2 chloride channel orthologs

Pérez-Rius, Carla; Gaitán‐Peñas, Héctor; Estévez, Raúl; Barrallo-Gimeno, Alejandro

doi:10.1007/s00424-014-1614-z

Cited by 18 publications

(21 citation statements)

References 56 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Consistent with a putative role for tilapia Clc-2c in Cl − uptake, we observed high clc-2c gene expression in the gill. Interestingly, we observed comparable expression levels in kidney, a pattern that differs from clc-2c patterns in zebrafish (Pérez-Ruis et al 2015, Wang et al 2015). Future studies should investigate whether Clc-2c supports Cl − transport by renal tubules.…”

Section: Discussionsupporting

confidence: 44%

“…Given the recently defined role for Clc-2c in mediating Cl − transport by zebrafish ionocytes (Pérez-Ruis et al 2015, Wang et al 2015), we started by characterizing the expression pattern of clc-2c across tissues collected from tilapia acclimated to FW (Fig. 1A).…”

Section: Discussionmentioning

confidence: 99%

“…No. XM_003459762) identified by Pérez-Ruis and coworkers (2015) were designed to span a predicted exon-exon junction: F: AGAAGGTCAGTCAGCCAAGC and R: AGCGAAATGGGCCGAACTT (product = 72 bp), and to not amplify clc-2a (XM_019347600) or clc-2b (XM_005461001). The qRT-PCR reactions were setup as previously described (Inokuchi et al 2015).…”

Section: Methodsmentioning

confidence: 99%

“…Convincing evidence established that Ncc2-expressing ionocytes are in fact critical to Na + and Cl − homeostasis (Hiroi et al 2008, Inokuchi et al 2008, Inokuchi et al 2009, Horng et al 2009, Wang et al 2009, Kwong & Perry 2016). A member of the Clc family of Cl − channels, Clc-2c, was subsequently proposed as a conduit for basolateral transport of Cl − from the interior of zebrafish Ncc-cells into blood plasma (Pérez-Ruis et al 2015, Wang et al 2015). Accordingly, low-Cl − environments stimulate clc-2c mRNA levels and the recruitment of Clc-2c-expressing ionocytes (Wang et al 2015).…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

clc-2c is regulated by salinity, prolactin and extracellular osmolality in tilapia gill

Breves

Keith

Hunt

et al. 2017

Journal of Molecular Endocrinology

View full text Add to dashboard Cite

Teleosts inhabiting fresh water depend upon ion-absorptive ionocytes to counteract diffusive ion losses to the external environment. A Clc Cl− channel family member, Clc-2c, was identified as a conduit for basolateral Cl− transport by Na+/Cl− cotransporter 2 (Ncc2)-expressing ionocytes in stenohaline zebrafish (Danio rerio). It is unresolved whether Clc-2c/clc-2c is expressed in euryhaline species and how extrinsic and/or intrinsic factors modulate branchial clc-2c mRNA. Here, we investigated whether environmental salinity, prolactin (Prl) and osmotic conditions modulate clc-2c expression in euryhaline Mozambique tilapia (Oreochromis mossambicus). Branchial clc-2c and ncc2 mRNAs were enhanced in tilapia transferred from seawater to fresh water, whereas both mRNAs were attenuated upon transfer from fresh water to seawater. Next, we injected hypophysectomized tilapia with ovine prolactin (oPrl) and observed a marked increase in clc-2c from saline-injected controls. To determine whether Prl regulates clc-2c in a gill-autonomous fashion, we incubated gill filaments in the presence of homologous tilapia Prls (tPrl177 and tPrl188). By 24 h, tPrl188 stimulated clc-2c expression ~5-fold from controls. Lastly, filaments incubated in media ranging from 280 to 450 mOsm/kg for 3 and 6 h revealed that extracellular osmolality exerts a local effect on clc-2c expression; clc-2c was diminished by hyperosmotic conditions (450 mOsm/kg) compared with isosmotic controls (330 mOsm/kg). Our collective results suggest that hormonal and osmotic control of branchial clc-2c contributes to the freshwater adaptability of Mozambique tilapia. Moreover, we identify for the first time a regulatory link between Prl and a Clc Cl− channel in a vertebrate.

show abstract

Section: Discussionsupporting

confidence: 44%

Section: Discussionmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

clc-2c is regulated by salinity, prolactin and extracellular osmolality in tilapia gill

Breves

Keith

Hunt

et al. 2017

Journal of Molecular Endocrinology

View full text Add to dashboard Cite

show abstract

“…Heat shock protein 90 can increase ClC-2 current amplitude and the intracellular Cl − concentration, and enhance channel sensitivity to intracellular Cl − (105). ClC-2 is also associated with the transmembrane glycoprotein, GlialCAM, in the brain, and GlialCAM can involve ClC-2 in the homeostasis of myelin, which is defective in leukodystrophy (106). …”

Section: Functional Properties Of Clc-2mentioning

confidence: 99%

Research and progress on ClC-2

Wang

Kong

et al. 2017

Molecular Medicine Reports

View full text Add to dashboard Cite

Chloride channel 2 (ClC-2) is one of the nine mammalian members of the ClC family. The present review discusses the molecular properties of ClC-2, including CLCN2, ClC-2 promoter and the structural properties of ClC-2 protein; physiological properties; functional properties, including the regulation of cell volume. The effects of ClC-2 on the digestive, respiratory, circulatory, nervous and optical systems are also discussed, in addition to the mechanisms involved in the regulation of ClC-2. The review then discusses the diseases associated with ClC-2, including degeneration of the retina, Sjögren's syndrome, age-related cataracts, degeneration of the testes, azoospermia, lung cancer, constipation, repair of impaired intestinal mucosa barrier, leukemia, cystic fibrosis, leukoencephalopathy, epilepsy and diabetes mellitus. It was concluded that future investigations of ClC-2 are likely to be focused on developing specific drugs, activators and inhibitors regulating the expression of ClC-2 to treat diseases associated with ClC-2. The determination of CLCN2 is required to prevent and treat several diseases associated with ClC-2.

show abstract

Messenger RNA typing of environmental RNA (eRNA): A case study on zebrafish tank water with perspectives for the future development of eRNA analysis on aquatic vertebrates

et al. 2020

View full text Add to dashboard Cite

As an alternative/supplement to conventional biodiversity survey methods, environmental DNA (eDNA) analysis has developed rapidly during the past decade, and is widely used for the biomonitoring of wildlife. However, the interpretation of eDNA results has been limited to the presence/absence or biomass/abundance of the target species because of uncertainty regarding the dynamics of eDNA in natural environments. This limitation may be ameliorated by targeting environmental RNA (eRNA). RNA is more prone to degrade than DNA and the pattern of messenger RNA (mRNA) expression changes depending on physiological conditions, meaning that the presence or concentration of mRNA could reflect the organism's presence with higher temporal resolution and provide information beyond simple presence/absence. Technical developments in the detection of eRNA focusing on mRNA with these distinct features could permit the advanced usage of genetic materials in water. In advancing this technique, we initiated this study asking that if we can detect elevated levels of eRNA whose genes are specific to a tissue source (e.g., gills or skin), then could not we infer the tissue origin of the genetic material detected. To this end, we developed gene‐specific primer sets for the target genes with biased expression in the gills, skin, and intestine, and conducted reverse transcription–polymerase chain reaction on zebrafish breeding tank water samples, obtaining positive results for all assays. The result of our experiment confirmed that the specific target tissues can be the source of genetic materials detected in water and with that we offer a proof of concept for eRNA analysis targeting specific mRNAs of aquatic vertebrates. In this commentary, we provide information on the experimental steps used for mRNA typing of eRNA from zebrafish as well as the limitations and challenges of this technique and the prospect of mRNA typing of eRNA in the future.

show abstract

Identification and characterization of the zebrafish ClC-2 chloride channel orthologs

Cited by 18 publications

References 56 publications

clc-2c is regulated by salinity, prolactin and extracellular osmolality in tilapia gill

clc-2c is regulated by salinity, prolactin and extracellular osmolality in tilapia gill

Research and progress on ClC-2

Messenger RNA typing of environmental RNA (eRNA): A case study on zebrafish tank water with perspectives for the future development of eRNA analysis on aquatic vertebrates

Contact Info

Product

Resources

About