Identification and characterization of mutations underlying Sanfilippo syndrome type A (mucopolysaccharidosis type IIIA)

Lee-Chen, GJ; Lin, Shuo; Ko, MH; Chuang, CK; Cp, Chen; Lee, HH; Cheng, SC; Ch, Shen; Tseng, KL; Cl, Li

doi:10.1034/j.1399-0004.2002.610304.x

Cited by 19 publications

(11 citation statements)

References 23 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Twenty‐one mutations were found, including 14 missense (67%), 2 splicing (10%), 2 frameshift (10%), 2 rearrangement (10%), and 1 nonsense (5%). Fourteen mutations were previously reported in the literature, as well as seven NAGLU gene mutations (MPS IIIB) were identified in this report for the first time (Beesley, Jackson, Young, Vellodi, & Winchester, ; Lee‐Chen et al, ; ; Mangas et al, ; Tang et al, ; Weber et al, ). Two of them were missense mutations (p.L498P and p.A9E), two were splicing mutations (c.383 + 1G > T and c.764 + 1G > A), two were rearrangement mutations (c.999_1019dupCGTCTATGAGGCCATGACTGC and p.T332_T338dup7), and one was frameshift mutation (c.252_253ins19).…”

Section: Resultsmentioning

confidence: 57%

“…A retrospective study was carried out for patients diagnosed with MPS III seen from January 1996 to October 2017 in six medical centers in Taiwan, including Mackay Memorial Hospital, Kaohsiung Veterans General Hospital, China Medical University Hospital, National Taiwan University Hospital, National Cheng Kung University Hospital, and Changhua Christian Children's Hospital. The diagnosis of MPS III was confirmed by measurements of enzymatic activities of particular lysosomal hydrolases in leukocytes or skin fibroblasts, two‐dimensional electrophoresis of urinary glycosaminoglycans (GAGs), and/or mutational analysis (Chuang, Lin, & Chung, ; Lee‐Chen et al, ). Information on 28 MPS III patients (types IIIA [ n = 3], IIIB [ n = 24], and IIIC [ n = 1]; 15 males and 13 females; mean age ± SD, 10.1 ± 5.7 years; median age, 8.2 years; age range, 2.7–26.5 years) was collected.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Mucopolysaccharidosis III in Taiwan: Natural history, clinical and molecular characteristics of 28 patients diagnosed during a 21‐year period

Lin

Chuang

Lee

et al. 2018

American J of Med Genetics Pt A

View full text Add to dashboard Cite

Mucopolysaccharidosis type III (MPS III, Sanfilippo syndrome) has a variable age of onset and variable rate of progression. However, information regarding the natural history of this disorder in Asian populations is limited. A retrospective analysis was carried out for 28 patients with MPS III (types IIIA [n = 3], IIIB [n = 23], and IIIC [n = 2]; 15 males and 13 females; median age, 8.2 years; age range, 2.7-26.5 years) seen in six medical centers in Taiwan from January 1996 through October 2017. The median age at confirmed diagnosis was 4.6 years. The most common initial symptom was speech delay (75%), followed by hirsutism (64%) and hyperactivity (54%). Both z scores for height and weight were negatively correlated with age (r = -.693 and -0.718, respectively; p < .01). The most prevalent clinical manifestations were speech delay (100%) and intellectual disability (100%), followed by hirsutism (93%), hyperactivity (79%), coarse facial features (68%), sleep disorders (61%), and hepatosplenomegaly (61%). Ten patients (36%) had epilepsy, and the median age at the first seizure was 11 years. Thirteen patients (46%) experienced at least one surgical procedure. At the time of the present study, 7 of the 28 patients had passed away at the median age of 13.0 years. Molecular studies showed an allelic heterogeneity without clear genotype and phenotype correlations. MPS IIIB is the most frequent subtype among MPS III in the Taiwanese population. An understanding of the natural history of MPS III may allow early diagnosis and timely management of the disease facilitating better treatment outcomes.

show abstract

Section: Resultsmentioning

confidence: 57%

Section: Methodsmentioning

confidence: 99%

Mucopolysaccharidosis III in Taiwan: Natural history, clinical and molecular characteristics of 28 patients diagnosed during a 21‐year period

Lin

Chuang

Lee

et al. 2018

American J of Med Genetics Pt A

View full text Add to dashboard Cite

show abstract

“…Our department is the major diagnostic center for MPS disorders in Taiwan [Lee‐Chen et al, 1999, 2002a,b; Yang et al, 2001; Lin et al, 2006; Chuang and Lin, 2007; Lin et al, 2008]. Most of the patients clinically suspected to have an MPS disorder are referred to our department for confirmation.…”

Section: Discussionmentioning

confidence: 99%

Incidence of the mucopolysaccharidoses in Taiwan, 1984–2004

Lin

Chuang

et al. 2009

American J of Med Genetics Pt A

161

139

View full text Add to dashboard Cite

Previous studies on the incidence of the various types of mucopolysaccharidoses (MPS) in different populations have shown considerable variation. However, information regarding the incidence of MPS in the Asian population is lacking. An epidemiological study of the MPS disorders in Taiwan using multiple ascertainment sources was undertaken, and incidences of different types of MPS during the period of 1984-2004 were estimated. We compared our data with previous reports in different populations. The combined birth incidence for all MPS cases was 2.04 per 100,000 live births. MPS II (Hunter syndrome) had the highest calculated birth incidence of 1.07 per 100,000 live births (2.05 per 100,000 male live births), comprising 52% of all MPS cases diagnosed. The birth incidences of MPS I (Hurler syndrome), III (Sanfilippo syndrome), IV (Morquio syndrome), and VI (Maroteaux-Lamy syndrome) were 0.11, 0.39, 0.33, and 0.14 per 100,000 live births, respectively, which accounted for 6%, 19%, 16%, and 7% of all MPS, respectively. No cases of MPS III D (Sanfilippo syndrome type D), MPS IV B (Morquio syndrome type B), MPS VII (Sly syndrome) or MPS IX were ascertained during the study period. Overall incidence of MPS in Taiwan was consistent with that reported in Western populations. However, in contrast to the higher incidence of MPS I in most Western populations, this study showed a higher incidence of MPS II in Taiwan. It remains to be investigated whether this discrepancy is attributed to the under-diagnosis of MPS I in Taiwan or to ethnic differences.

show abstract

“…For the sake of simplicity, only the structural formula of the terminal sulfated glucosamine residue is shown. The capital letters A to D indicate the steps deficient in Sanfilippo type A to D. GlcNAc=N-acetylglucosamine; IDU=L-iduronic acid; GLUCU=glucuronic acid mutations have been reported (Beesley et al 2000;Blanch et al 1997;Bunge et al 1997;Di Natale et al 1998Emre et al 2002;Esposito et al 2000;Gabrielli et al 2005;Lee-Chen et al 2002a;Montfort et al 1998;Scott et al 1995;Weber et al 1997;Wood and Thompson 2000). These include 48 missense mutations, four nonsense mutations, one splice site mutation, eight small deletions, and seven small insertions (Di Natale et al 2006;Emre et al 2002;Yogalingam and Hopwood 2001).…”

Section: Mps Iiiamentioning

confidence: 99%

Sanfilippo syndrome: A mini‐review

Valstar

Ruijter

Diggelen

et al. 2008

J of Inher Metab Disea

330

379

View full text Add to dashboard Cite

Mucopolysaccharidosis type III (MPS III, Sanfilippo syndrome) is an autosomal recessive disorder, caused by a deficiency in one of the four enzymes involved in the lysosomal degradation of the glycosaminoglycan heparan sulfate. Based on the enzyme deficiency, four different subtypes, MPS IIIA, B, C, and D, are recognized. The genes encoding these four enzymes have been characterized and various mutations have been reported. The probable diagnosis of all MPS III subtypes is based on increased concentration of heparan sulfate in the urine. Enzymatic assays in leukocytes and/or fibroblasts confirm the diagnosis and allow for discrimination between the different subtypes of the disease. The clinical course of MPS III can be divided into three phases. In the first phase, which usually starts between 1 and 4 years of age, a developmental delay becomes apparent after an initial normal development during the first 1-2 years of life. The second phase generally starts around 3-4 years and is characterized by severe behavioural problems and progressive mental deterioration ultimately leading to severe dementia. In the third and final stage, behavioural problems slowly disappear, but motor retardation with swallowing difficulties and spasticity emerge. Patients usually die at the end of the second or beginning of the third decade of life, although survival into the fourth decade has been reported. Although currently no effective therapy is yet available for MPS III, several promising developments raise hope that therapeutic interventions, halting the devastating mental and behavioural deterioration, might be feasible in the near future.

show abstract

Identification and characterization of mutations underlying Sanfilippo syndrome type A (mucopolysaccharidosis type IIIA)

Cited by 19 publications

References 23 publications

Mucopolysaccharidosis III in Taiwan: Natural history, clinical and molecular characteristics of 28 patients diagnosed during a 21‐year period

Mucopolysaccharidosis III in Taiwan: Natural history, clinical and molecular characteristics of 28 patients diagnosed during a 21‐year period

Incidence of the mucopolysaccharidoses in Taiwan, 1984–2004

Sanfilippo syndrome: A mini‐review

Contact Info

Product

Resources

About