<i>Wnt9b</i> is the mutated gene involved in multifactorial nonsyndromic cleft lip with or without cleft palate in A/WySn mice, as confirmed by a genetic complementation test

Juriloff, D. M.; Harris, Muriel J.; McMahon, Andrew P.; Carroll, Thomas J.; Lidral, Andrew C.

doi:10.1002/bdra.20302

Cited by 124 publications

(138 citation statements)

References 22 publications

(36 reference statements)

Supporting

Mentioning

127

Contrasting

Unclassified

Order By: Relevance

“…Several reports discuss changes in Wnt family member gene expression in association with cleft palate, but only recently was loss of Wnt9b purported to be causal in the etiology of cleft palate in a mouse model (14). In this report, the authors confirmed that the previously described mutation clf1 in A/WySn mice was a mutation of the Wnt9b gene by a standard genetic test of allelism.…”

Section: Cleft Palatesupporting

confidence: 64%

Tissue Engineering in Cleft Palate and Other Congenital Malformations

et al. 2008

View full text Add to dashboard Cite

ABSTRACT:Contributions from multidisciplinary investigations have focused attention on the potential of tissue engineering to yield novel therapeutics. Congenital malformations, including cleft palate, craniosynostosis, and craniofacial skeletal hypoplasias represent excellent targets for the implementation of tissue engineering applications secondary to the technically challenging nature and inherent inadequacies of current reconstructive interventions. Apropos to the search for answers to these clinical conundrums, studies have focused on elucidating the molecular signals driving the biologic activity of the aforementioned maladies. These investigations have highlighted multiple signaling pathways, including Wnt, fibroblast growth factor, transforming growth factor-␤, and bone morphogenetic proteins, that have been found to play critical roles in guided tissue development. Furthermore, a comprehensive knowledge of these pathways will be of utmost importance to the optimization of future cell-based tissue engineering strategies. The scope of this review encompasses a discussion of the molecular biology involved in the development of cleft palate and craniosynostosis. In addition, we include a discussion of craniofacial distraction osteogenesis and how its applied forces influence cell signaling to guide endogenous bone regeneration.

show abstract

Section: Cleft Palatesupporting

confidence: 64%

Tissue Engineering in Cleft Palate and Other Congenital Malformations

et al. 2008

View full text Add to dashboard Cite

show abstract

“…In humans, mutations in the WNT3 gene are associated with tetraamelia and cleft lip and palate (Niemann et al, 2004). The A/WySn strain of mice exhibits an increased incidence of cleft lip and palate, and recent data indicate that this increased incidence can be exacerbated still further by deleting Wnt9b (Juriloff et al, 2006). Here, our data indicate a novel role for Wnt signaling in regulating species-specific craniofacial morphogenesis.…”

Section: Craniofacial Growth Is Influenced By Wnt Signalingmentioning

confidence: 51%

Wnt signaling mediates regional specification in the vertebrate face

et al. 2007

View full text Add to dashboard Cite

At early stages of development, the faces of vertebrate embryos look remarkably similar, yet within a very short timeframe they adopt species-specific facial characteristics. What are the mechanisms underlying this regional specification of the vertebrate face? Using transgenic Wnt reporter embryos we found a highly conserved pattern of Wnt responsiveness in the developing mouse face that later corresponded to derivatives of the frontonasal and maxillary prominences. We explored the consequences of disrupting Wnt signaling, first using a genetic approach. Mice carrying compound null mutations in the nuclear mediators Lef1 and Tcf4 exhibited radically altered facial features that culminated in a hyperteloric appearance and a foreshortened midface. We also used a biochemical approach to perturb Wnt signaling and found that in utero delivery of a Wnt antagonist, Dkk1, produced similar midfacial malformations. We tested the hypothesis that Wnt signaling is an evolutionarily conserved mechanism controlling facial morphogenesis by determining the pattern of Wnt responsiveness in avian faces, and then by evaluating the consequences of Wnt inhibition in the chick face. Collectively, these data elucidate a new role for Wnt signaling in regional specification of the vertebrate face, and suggest possible mechanisms whereby species-specific facial features are generated.

show abstract

“…The mice were genotyped according to published protocols, except for the Pu⌬TK selector mouse line, for which we developed the following genotyping primers (from 5Ј to 3Ј): Hprtexon3rev, CTTACACAG-TAGCTC TTCAGTCTG; Hprtexon3for, TTTCTATAGGACTGAAAGACTTGC; and PgkNeoPromRev, GTGCTACTTC-CATTTGTCACGTCC, which yield a WT band of 187 bp, and a target band of 402 bp. Since the Pu⌬TK transgene is X-linked we also genotyped embryos for sex according to published protocols (Juriloff et al, 2006).…”

Section: Experimental Procedures Transgenic Mouse Lines and Genotypingmentioning

confidence: 99%

Temporal–spatial ablation of neural crest in the mouse results in cardiovascular defects

Porras

Brown

2007

Developmental Dynamics

View full text Add to dashboard Cite

Neural crest cells are thought to play a critical role in human conotruncal morphogenesis and dysmorphogenesis. Much of our understanding of the contribution of neural crest to cardiovascular patterning comes from ablation and transplantation experiments in avian species. Although fate mapping experiments in mice suggests a conservation of function, the functional requirement for neural crest in cardiovascular development in mammals has not been formally tested. We used a novel two component genetic system for the temporal-spatial ablation of neural crest in the mouse. Affected embryos displayed a spectrum of cardiovascular outflow tract defects and aortic arch patterning abnormalities. We show that the severity of the cardiovascular phenotype is directly related to the level and extent of neural crest ablation. This is the first report of cardiac neural crest ablation in mammals, and it provides important insight into the role of the mammalian neural crest during cardiovascular development. Developmental Dynamics 237:153-162, 2008.

show abstract

Wnt9b is the mutated gene involved in multifactorial nonsyndromic cleft lip with or without cleft palate in A/WySn mice, as confirmed by a genetic complementation test

Abstract: The noncomplementation of clf1 and Wnt9b- confirms that clf1 is a mutation of the Wnt9b gene. The homologous human WNT9B gene and 3' conserved noncoding region should be examined for a role in human nonsyndromic CLP.

Cited by 124 publications

References 22 publications

Tissue Engineering in Cleft Palate and Other Congenital Malformations

Tissue Engineering in Cleft Palate and Other Congenital Malformations

Wnt signaling mediates regional specification in the vertebrate face

Temporal–spatial ablation of neural crest in the mouse results in cardiovascular defects

Contact Info

Product

Resources

About