Trypanosoma irwini n. sp (Sarcomastigophora: Trypanosomatidae) from the koala (Phascolarctos cinereus)

Abstract

The morphology and genetic characterization of a new species of trypanosome infecting koalas (Phascolarctos cinereus) are described. Morphological analysis of bloodstream forms and phylogenetic analysis at the 18S rDNA and gGAPDH loci demonstrated this trypanosome species to be genetically distinct and most similar to Trypanosoma bennetti, an avian trypanosome with a genetic distance of 0 . 9% at the 18S rDNA and 10 . 7 % at the gGAPDH locus. The trypanosome was detected by 18S rDNA PCR in the blood samples of 26 out of 68 (38 . 2%) koalas studied. The aetiological role of trypanosomes in koala disease is currently poorly defined, although infection with these parasites has been associated with severe clinical signs in a number of koalas. Based on biological and genetic characterization data, this trypanosome species infecting koalas is proposed to be a new species Trypanosome irwini n. sp.

Novel trypanosomeTrypanosoma gillettisp. (Euglenozoa: Trypanosomatidae) and the extension of the host range ofTrypanosoma copemanito include the koala (Phascolarctos cinereus)

“…(KG1) and T. pestanai, as these are the only T. copemani clade isolates with available gGAPDH sequences. The overall topology of the concatenated 18S rDNA and gGAPDH ML tree produced in order to determine the evolutionary position of T. gilletti amongst the trypanosomes was similar to equivalent trees previously presented (Hamilton et al 2007;McInnes et al 2009;Viola et al 2009). The placement of T. gilletti in the T. copemani clade was supported by high aLRT branch support and bootstrap values (99-100%) in the 18S rDNA and gGAPDH analysis individually and in the concatenated analysis.…”

“…18S rDNA amplification and sequencing DNA was screened for the presence of trypanosomatid 18S rDNA as previously described by McInnes et al (2009) with the correction of primer S823 (cgaacaactgccctatcagc) sourced from Maslov et al (1996) rather than S825 being used in conjunction with primer S662 as incorrectly stated. The approximate 1500 bp fragment of 18S rDNA generated includes variable regions V3, V4, V6 and the V7-V8 variable region used by Da Silva et al (2004) Hamilton et al (2004), as the utility of 18S rDNA for deep level phylogeny has been questioned (Hamilton et al 2004).…”

First report of Trypanosoma vegrandis in koalas (Phascolarctos cinereus)

“…Relatively little is known about trypanosome species infecting Australian mammals with only eight species formally identified to date, three of them (Trypanosoma irwini, T. copemani and T. gilletti) in the koala (Phascolarctos cinereus) [1][2][3].…”

“…Therefore, an approximately 900 bp fragment of the 18S rRNA gene was amplified using primers S823F and S662 sourced from Maslov et al [12], as external primers according to McInnes et al [2]. The PCR product from these external primers was run on a 2% agarose gel stained with SYBR safe (Invitrogen, USA).…”

Vector of Trypanosoma copemani identified as Ixodes sp.

“…Australian trypanosomes have been found in a wide range of marsupials from mainland Australia (Mackerras, 1959;Noyes et al 1999;Jakes et al 2001;Hamilton et al 2005;Austen et al 2009;McInnes et al 2009) as well as offshore islands (Bettiol et al 1998). A recent survey of the infection status of the quokkas on Rottnest Island off the coast of Western Australia revealed that these animals are not infected with T. copemani (J. Austen, unpublished data) whereas quokkas on Bald Island and at Two Peoples Bay are infected.…”