TERTPromoter Mutations but not the Alternative Lengthening of Telomeres Phenotype Are Present in a Subset of Ependymomas and Are Associated With Adult Onset and Progression to Ependymosarcoma

Abstract

Genetic signatures related to telomere maintenance have emerged as powerful classifiers among CNS tumors. These include the alternative lengthening of telomeres (ALT) phenotype associated with mutations in the ATRX and DAXX genes and recurrent point mutations in the TERT gene promoter. We investigated a patient cohort covering the entire spectrum of childhood and adult ependymomas (n = 128), including subependymomas and myxopapillary ependymomas, for the presence of TERT promoter mutations, for loss of ATRX or DAXX expression by immunohistochemistry (as surrogates as underlying gene mutations), and for the ALT phenotype by fluorescence in situ hybridization (FISH). TERT promoter mutations were identified in 9/120 (7%) of tumors, all of which were conventional ependymomas occurring in adults. TERT promoter mutations were associated with older age and intracranial localization. Remarkably, 2 of these tumors progressed to ependymosarcoma upon recurrence. No tumors displayed an ALT phenotype by FISH or were ATRX or DAXX deficient by immunohistochemistry. In sum, TERT promoter mutations are present in a subset of mostly intracranial conventional ependymomas in adults and may be relevant for the uncommon progression to ependymosarcoma. Loss of ATRX immunoreactivity is a useful marker to rule out ependymoma in specific diagnostic settings.

Genetic predisposition to longer telomere length and risk of childhood, adolescent and adult-onset ependymoma

“…The telomerase enzyme is normally expressed in stem and progenitor cells to maintain telomere length, but is suppressed in somatic tissues. Telomerase activity is reactivated in many cancer subtypes, including ependymomas [ 4 , 9 , 13 , 23 , 31 ]. Telomerase activity has been linked to ependymoma progression, recurrence, and survival, and has been implicated as an important prognostic marker and therapeutic target [ 23 , 50 , 51 ], where telomerase inhibition has demonstrated anti-tumorigenic effects in in vitro and xenograft models of pediatric ependymoma [ 4 , 58 ].…”

“…Telomere dysfunction has also been linked to chromothrypsis, a form of genomic instability characterized by tens to hundreds of clustered DNA rearrangements, which was previously associated with greater telomere length in medulloblastoma and ependymoma [ 20 ]. TERT promotor mutations that reactivate telomerase in glioblastoma have occasionally been identified in adult ependymoma, but not in children [ 4 , 9 , 31 ]. In pediatric ependymoma, hypermethylation of the TERT promotor has consistently been associated with telomerase reactivation [ 13 , 23 ], indicating that epigenetic mechanisms of telomere maintenance may also enable replicative immortality in ependymoma cells.…”

“…This is typically achieved through telomerase reactivation or through a homologous recombination-associated process referred to as alternative lengthening of telomeres (ALT) [ 26 , 37 ]. While dysregulated telomere biology has been implicated in ependymoma progression and prognosis [ 46 , 50 , 51 ], the TERT promoter mutations associated with telomerase reactivation are uncommon in both childhood and adult ependymomas, as are the ATRX mutations associated with ALT [ 9 ]. Individuals who are genetically predisposed to longer telomere length or more efficient telomere maintenance are at increased risk of adult glioma and childhood neuroblastoma [ 53 , 55 ], perhaps due to an enhanced capacity for pre-malignant cells to divide and acquire additional oncogenic mutations before their telomere reserves are depleted [ 2 , 56 ].…”

Differential Regulation of Telomeric Complex by BCR-ABL1 Kinase in Human Cellular Models of Chronic Myeloid Leukemia—From Single Cell Analysis to Next-Generation Sequencing

“…TERT promoter hotspot mutations (C228T and C250T) were analysed by NGS, but due to low coverage of the promotor region, also additionally confirmed by Sanger sequencing as described [ 23 ], with modifications. Briefly, primer sequences were as follows: TERT-F: AGGAGGCTCTTTGGAGCAAG, TERT-R: CTCTGAACTCTGTGCTGACCA.…”

Ependymoma

“…TERT promoter mutations are associated with older age and intracranial location, whereas TERT mutations are not seen in pediatric ependymomas. 50,51 Chromosome 1q gain, epidermal growth factor receptor (EGFR) expression, and nucleolin expression have been reported in subsets of adult ependymomas as well as in children, but the clinical significance of this information is unknown, although there are drugs that can target EGFR, such as lapatinib, leading to exploration of lapatinib in a clinical trial for adult ependymoma patients. 52,53 Presentation and Diagnosis…”