Snrpb is required in murine neural crest cells for proper splicing and craniofacial morphogenesis

Abstract

Heterozygous mutations in SNRPB, an essential core component of the five small ribonucleoprotein particles of the spliceosome, are responsible for Cerebrocostomandibular Syndrome (CCMS). We show that Snrpb heterozygous embryos arrest shortly after implantation. Additionally, heterozygous deletion of Snrpb in the developing brain and neural crest cells models craniofacial malformations found in CCMS, and results in death shortly after birth. RNAseq analysis of mutant heads prior to morphological defects revealed increased exon-skipping and intron-retention in association with increased 5’ splice site strength. We found increased exon-skipping in negative regulators of the P53-pathway, increased levels of nuclear P53, P53-target genes. However, removing TrP53 in Snrpb heterozygous mutant neural crest cells did not completely rescue craniofacial development. We also found a small but significant increase in exon-skipping of several transcripts required for head and midface development, including Smad2 and Rere. Furthermore, mutant embryos exhibited ectopic or missing expression of Fgf8 and Shh, which are required to coordinate face and brain development. Thus, we propose that mis-splicing of transcripts that regulate P53-activity and craniofacial-specific genes both contribute to craniofacial malformations.

Identification of a link between splicing and endoplasmic reticulum proteostasis

“…In light of the effect of SNRPB on ER export, we hypothesized that loss of SNRPB might cause defects in trafficking of type-I collagen. We therefore performed immunofluorescence staining in neural crest tissue from wild type mice and Snrpb neural crest specific heterozygous ( Snrpb ncc+/- ), which we described recently(Alam et al , 2022). In the tissue of wild type mice, collagen-I was distributed mostly extracellularly and to some extent intracellularly (Figure 1D).…”

“…We previously showed that embryos with heterozygous loss of function mutation in Snrpb arrested at embryonic day (E) 8.5 (Alam et al ., 2022), indicating an early requirement for this gene during gastrulation. We also showed bone deformities in the craniofacial region of neural-crest cell Snrpb mutants.…”

“…Wnt1-Cre2 (Lewis et al , 2013) mice on the C57BL/6J genetic background were purchased from The Jackson Laboratory (strain#: 022501). The development of a conditional knock-out Snrpb allele with CRISPR/Cas9-mediated homology directed repair (HDR) strategy was previously described (Alam et al ., 2022).…”

“…Yolk sacs were used for genomic DNA extraction and genotyping (Hou et al , 2017). Genotyping to identify Snrpb wild-type and conditional allele (with loxP sequences) was previously described (Alam et al ., 2022). The primers used for the genotyping were: forward-5’ CCCGAGACAGACACAACATAAG 3’, reverse-5’ GCTTTGAAGGTCCCGATGAA 3’.…”

First person – Sabrina Alam

“… ABSTRACT First Person is a series of interviews with the first authors of a selection of papers published in Disease Models & Mechanisms, helping early-career researchers promote themselves alongside their papers. Sabrina Alam is first author on ‘ Snrpb is required in murine neural crest cells for proper splicing of genes essential for craniofacial morphogenesis ’, published in DMM. Sabrina is a PhD student in the lab of Dr Loydie A. Jerome-Majewska at McGill University, Montreal, Canada, investigating the role of splicing in the complexity of craniofacial development.…”