<i>Nocardia veterana</i>
            Isolated from Ascitic Fluid of a Patient with Human Immunodeficiency Virus Infection

Godreuil, Sylvain; Didelot, Marie-Noëlle; Pérez, C.; Leflèche, Anne; Boiron, P.; Reynes, Jacques; Laurent, François; Jean-Pierre, Hélène; Marchandin, Hélène

doi:10.1128/jcm.41.6.2768-2773.2003

Cited by 19 publications

(17 citation statements)

References 28 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Positive results were for pyrazinamidase, alkaline phosphatase, ␣-glucosidase, and gelatin hydrolysis. These results prompted us to determine the 16S rRNA gene sequence of the isolate as previously described (3). Briefly, the 16S rRNA gene was amplified by PCR with the primers Al (5Ј-AGRGTTYGATYCTGGCTCAGGAYG-3Ј) and rJ (5Ј-GGTTACCTTGTTACGACTT-3Ј) (5).…”

mentioning

confidence: 99%

Bacteremia Caused by an Undescribed Species of Janibacter

et al. 2005

View full text Add to dashboard Cite

A yellow-pigmented rod-to coccoid-shaped coryneform microorganism was isolated from the blood of a patient with acute myeloid leukemia. It was identified by 16S rRNA gene sequencing as a previously undescribed species of Janibacter. The isolate was susceptible to penicillins, aminoglycosides, fluoroquinolones, and glycopeptides. CASE REPORTIn October 2001, an acute myeloid leukemia was diagnosed in a 51-year-old man. Karyotype analysis confirmed the presence of the Philadelphia chromosome, resulting from a reciprocal translocation between chromosomes 9 and 22 that leads to the production of an abnormal fusion protein (b2a2) with tyrosine kinase activity. The patient was treated with oral hydroxyurea (50 mg/kg of body weight/day for 3 days) followed by a combination of intravenous cytarabine (200 mg/m 2 /day for 7 days) and intravenous idarubicin (8 mg/m 2 /day for 5 days). When complete remission was achieved, as shown by the normalization of blood cell counts and karyotype, the patient was treated with imatinib (400 mg/day per os), a specific inhibitor of the abnormal tyrosine kinase protein. On 15 January 2002, the patient was admitted at the University Hospital of Hôtel-Dieu (Paris, France) to undergo an allogeneic hematopoietic stem cell transplantation. On day 0 (D0; hereafter, all days are designated with reference to D0, with days before D0 being assigned negative values [e.g., DϪ9 is 9 days before D0] and days after D0 being assigned positive values [e.g., Dϩ3 is 3 days after D0), 8 February 2002, bone marrow cells were collected from his full-matched HLA-identical brother and infused. Before the transplantation, a myeloablative conditioning regimen consisting of oral busulfan (1 mg/kg/6 h from DϪ9 to DϪ6) in combination with cyclophosphamide (60 mg/kg/day from DϪ4 to DϪ3) through a central venous catheter was administrated. The catheter had been introduced in January and kept in place for the following weeks. Graft-versus-host disease (GVHD) prophylaxis consisted of intravenous first and then oral cyclosporine (4 mg/kg/day from DϪ1 to Dϩ180) in combination with intravenous methotrexate (15 mg/m 2 at Dϩ1 and 10 mg/m 2 at Dϩ3 and Dϩ6

show abstract

mentioning

confidence: 99%

Bacteremia Caused by an Undescribed Species of Janibacter

et al. 2005

View full text Add to dashboard Cite

show abstract

“…A pulmonary infection was diagnosed for most of those patients, whereas 2 patients showed an abdominal localization (7,15) and another had a mycetoma (9). Here, we present the first description of a brain abscess caused by Nocardia veterana.…”

mentioning

confidence: 90%

“…Here, we present the first description of a brain abscess caused by Nocardia veterana. For 9 of the 13 patients, a clear underlying cause of an immunocompromised condition, such as the use of immunosuppressive drugs (4,14) or the presence of human immunodeficiency virus (HIV) infection (7,12) or of an autoimmune disorder such as systemic lupus erythematosus (SLE) (9,10,14), could be diagnosed. Four patients had no apparent cause of immunodeficiency (8,14,15).…”

mentioning

confidence: 99%

First Report of a Brain Abscess Caused by Nocardia veterana

et al. 2011

View full text Add to dashboard Cite

Among Nocardia species causing infections, Nocardia veterana is rarely isolated and is mostly described as causing pulmonary infections. This is the first presentation of a case of brain abscess attributable to an N. veterana infection in a patient with type 2 diabetes. Prolonged antibiotic therapy with trimethoprim-sulfamethoxazole led to successful clinical recovery. CASE REPORTA 73-year-old man was admitted to a regional hospital with complaints of weight loss and a few days of stomachache. His past medical history revealed type 2 diabetes mellitus (DM2) without secondary complications, hypertension, an appendectomy, and a transient ischemic attack. Clinical suspicion of an intestinal obstruction led to a laparotomy, revealing no abnormalities. In the postoperative period, behavioral changes occurred, with passive behavior, slow speech, and an abnormal head positioning to the right side. No vomiting was observed. A computed tomography (CT) scan of the brain showed a large abscess in the left cerebral hemisphere with surrounding edema (Fig. 1). A further radiological examination using CT scans of the thorax and abdomen did not show any other abscesses. Dexamethasone therapy was immediately started, resulting in neurological improvement. The patient was transferred to our academic center, where his physical examination at presentation was unremarkable, while a neurological examination revealed no abnormalities except for disorientation with respect to place and time. Furthermore, brainstem reflexes and lower and upper extremity reflexes were normal. Laboratory analysis at admission showed the following: alkaline phosphatase (AF), 202 U/liter; gamma glutamyltransferase (␥-GT), 277 U/liter; aspartate aminotransferase (ASAT), 46 U/liter; alanine aminotransferase (ALAT), 108 U/liter; lactate dehydrogenase (LDH), 225 U/liter; C-reactive protein (CRP), Ͻ2 mg/liter; hemoglobin (Hb), 7.4 mmol/liter; leukocytes, 20 ϫ 10e9/liter; neutrophils, 18.1 ϫ 10e9/liter; thrombocytes, 383 ϫ 10e9/liter; erythrocyte sedimentation rate (ESR), 9 mm in the first hour; creatinine, 83 mol/liter; glucose, 11.8 mmol/liter.After trepanation and drainage of the abscess was performed, Gram staining revealed branching, bead-staining, Gram-positive rods that were acid fast as shown by a modified Ziehl-Neelsen staining procedure. Cultures on blood agar plates produced a pure growth of Nocardia sp. after 2 days. Using phenotypic tests, the national reference laboratory (Laboratory for Infectious Disease [LIS]-RIVM, Bilthoven, the Netherlands) identified the isolate as Nocardia veterana (aerobic growth at 37°C and 45°C, D-glucose negative, catalase positive, negative for nitrate reductase production and positive for urease production, negative for utilization of Simmons citrate as a sole source of carbon, positive for hydrolysis of esculin, but negative for tyrosine and xanthine). N. veterana was identified using 16S rRNA gene sequence analysis of 500 bp (ABI MicroSeq500 16S rDNA bacterial identification kit) and GenBank and the Ribosomal Database...

show abstract

“…In a routine experiment using the highly conserved 16S rRNA gene primers pA (AGAGTTTGATCCTGGCTCAG) and pH (AAGGAGGTGATCCAGCCGCA) designed by Edwards et al (4) and used by others (6,12,13), we observed a number of unexpected PCR products with sizes ranging from 100 bp to more than 2.0 kb, in addition to the expected 1.5-kb band amplified from the 16S rRNA gene (Fig. 1, band D).…”

mentioning

confidence: 99%