Heteropogon triticeus, a New Host of Claviceps sorghi in India

Abstract

Claviceps sorghi occurred on Heteropogon triticeus in Gulbarga, Karnataka, India. Its external sphacelial morphology on this species differed from that on sorghum in having long white sphacelial tips that protruded from spikelets or wound around awns. The tips were formed by parallel synnema‐like hyphae and were covered by a phialide layer that produced elongated macroconidia (7–18 μm) and rounded to oval microconidia (3–5 μm). Unlike the macroconidia, the microconidia failed to germinate. Plated macroconidia underwent secondary sporulation. The white sclerotial stroma consisted of parallel hyphae with cylindrical cells that later became rounded due to accumulation of reserve metabolites. Some of these cells differentiated into a sclerotial rind that accumulated a terracotta‐coloured pigment. RAPD patterns and the rDNA nucleotide sequence confirmed the identity of the species.

Genetic diversity of Claviceps africana on sorghum and Hyparrhenia

“…Additionally, three isolates were obtained from frozen honeydew samples that had been collected in Matopos (Zimbabwe) in 1992. Isolates were made by plating honeydew from each sorghum sample onto T2 sucrose–asparagine agar as previously described (Pažoutová et al ., 2002a).…”

“…An additional comparison of RAPD and ITS‐5·8S rDNA sequence data was facilitated when the conidia in honeydew, or the sclerotia, were viable. Isolates were obtained from honeydew (Pažoutová et al ., 2002a) or following the surface sterilization of sclerotia by 2% sodium hypochlorite (diluted Clorox) for 4 min, two rinses with sterile distilled water and plating on T2 agar.…”

“…DNA preparation, RAPD and rDNA sequencing methods used in this study are described in detail elsewhere (Pažoutová et al ., 2000b, 2002a). For RAPD analysis, primers OPA01 (CAGGCCCTTC), OPA09 (GGGTAACGCC), 8F (GCTCTGAGATTGTTCCGGCT), 30F (GAGGACGATTCATCAACC), 5R (TTTGTCCGGCTCAGAAAC), 10R (GGCCAGTGTGAATATGC) and ITP5 (CCGGCTTGTATTGG) were used.…”

Ergot fungusClaviceps cynodontisfound on Bermuda grass (Cynodon dactylon) in the Americas

“…Each isolate was prepared from a different floret. Pieces of agar with conidia undergoing the microcycle phase were repeatedly subcultured after the first 18 h of incubation as described in Pañoutová et al (2002). After 1 week, the pieces were transferred on T2 agar slants and incubated for 4-6 weeks.…”

Patterns of release of the secondary conidia of Claviceps africana, the sorghum ergot pathogen in Australia

“…These two conidial types become immersed in sugary honeydew which fills the spikelet, and ultimately oozes from the tip. For C. africana , and rarely for C. sorghi , macroconidia near the surface of the honeydew germinate iteratively, each producing a single, hyaline, aseptate, pyriform, secondary conidium at the apex of a sterigma (Bandyopadhyay et al ., 1990, 1996; Frederickson et al ., 1991; Pažoutová et al ., 2002). Secondary conidia are also produced on honeydew which drips onto the ground and plant parts below the panicles (Frederickson et al ., 1989; Bandyopadhyay et al ., 1996).…”