<i>Fusobacterium necrophorum</i>Leukotoxin Induces Activation and Apoptosis of Bovine Leukocytes

Narayanan, Sanjeev; Stewart, George C.; Chengappa, M. M.; Willard, Lloyd; Shuman, Wilma; Wilkerson, Melinda J.; Nagaraja, T. G.

doi:10.1128/iai.70.8.4609-4620.2002

Cited by 63 publications

(45 citation statements)

References 39 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…Roberts (321) was first to document a leukotoxin activity in F. necrophorum. Since then the nature and action of the toxin have been fully characterized (282,284,374). Several studies have shown a correlation between virulence and leukotoxin production (99,126).…”

Section: Bacterial Virulence Factorsmentioning

confidence: 99%

Human Infection withFusobacterium necrophorum(Necrobacillosis), with a Focus on Lemierre's Syndrome

2007

View full text Add to dashboard Cite

SUMMARYSummary:Human infection withFusobacterium necrophorumusually involvesF. necrophorumsubsp.funduliformerather thanF. necrophorumsubsp.necrophorum, which is a common pathogen in animals. Lemierre's syndrome, or postanginal sepsis, is the most common life-threatening manifestation. Tonsillitis is followed by septic thrombophlebitis of the internal jugular vein and then a septicemia with septic emboli in lungs and other sites. Recent evidence suggests thatF. necrophorumcan be limited to the throat and cause persistent or recurrent tonsillitis.F. necrophorumis unique among non-spore-forming anaerobes, first for its virulence and association with Lemierre's syndrome as a monomicrobial infection and second because it seems probable that it is an exogenously acquired infection. The source of infection is unclear; suggestions include acquisition from animals or human-to-human transmission. Approximately 10% of published cases are associated with infectious mononucleosis, which may facilitate invasion. Recent work suggests that underlying thrombophilia may predispose to internal jugular vein thrombophlebitis. Lemierre's syndrome was relatively common in the preantibiotic era but seemed to virtually disappear with widespread use of antibiotics for upper respiratory tract infection. In the last 15 years there has been a rise in incidence, possibly related to restriction in antibiotic use for sore throat.

show abstract

Section: Bacterial Virulence Factorsmentioning

confidence: 99%

Human Infection withFusobacterium necrophorum(Necrobacillosis), with a Focus on Lemierre's Syndrome

2007

View full text Add to dashboard Cite

show abstract

“…Like its relative F. necrophorum, F. nucleatum possesses many virulence factors, such as porin, other outer membrane proteins, and a potent lipopolysaccharide (6,65). Further, toxic metabolites, e.g., butyrate, propionate, and ammonia, are considered to be important in the virulence of these organisms (33,50,57). In concert with other pathogenic bacteria, F. nucleatum appears to play an important part in the destruction of periodontal tissue (7,18).…”

mentioning

confidence: 99%

“…In any of the scenarios the decisive determinant of cell behavior is the signaling system that is activated in the host cell upon infection (19,39,42,58). For instance, a specific leukotoxin produced by F. necrophorum induces signaling for apoptosis in neutrophils (50). F. nucleatum does not express a true leukotoxin, but it can adhere to epithelial cells and invade them by exploiting the cell signaling and the cytoskeletal elements of the host cells (26,28,51,73).…”

mentioning

confidence: 99%

Fusobacterium nucleatum Increases Collagenase 3 Production and Migration of Epithelial Cells

et al. 2005

View full text Add to dashboard Cite

Fusobacterium nucleatum is closely associated with human periodontal diseases and may also be a causative agent in other infections, such as pericarditis, septic arthritis, and abscesses of tonsils and liver. Initiation and outcome of infective diseases depend critically on the host cell signaling system altered by the microbe. Production of proteinases by infected cells is an important factor in pericellular tissue destruction and cell migration. We studied binding of F. nucleatum to human epithelial cells (HaCaT keratinocyte line) and subsequent cell signaling related to collagenase 3 expression, cell motility, and cell survival, using a scratch wound cell culture model. F. nucleatum increased levels of 12 protein kinases involved in cell migration, proliferation, and cell survival signaling, as assessed by the Kinetworks immunoblotting system. Epithelial cells of the artificial wound margins were clearly preferential targets of F. nucleatum. The bacterium colocalized with lysosomal structures and stimulated migration of these cells. Of the 13 anaerobic oral bacterial species, F. nucleatum and Fusobacterium necrophorum were among the best inducers of collagenase 3 mRNA levels, a powerful matrix metalloproteinase. Production of collagenase 3 was detected in fusobacterium-infected cells and cell culture medium by immunocytochemistry, immunoblotting, and zymography. The proteinase production involved activation of p38 mitogen-activated protein kinase in the infected cells. The study suggests that F. nucleatum may be involved in the pathogenesis of periodontal diseases (and other infections) by activating multiple cell signaling systems that lead to stimulation of collagenase 3 expression and increased migration and survival of the infected epithelial cells.

show abstract

“…16 Fusobacterium isolates were grown in prereduced anaerobically sterilized brain-heart infusion at 37°C to an absorbance of 0.7-0.8 at 600 nm, placed on ice, and pelleted by centrifugation at 10,000 × g for 10 min at 4°C as previously described. 25 Supernatants were filter sterilized with 0.22-μm membrane filters and stored at −80°C.…”

Section: Leukotoxicity Assay By Flow Cytometrymentioning

confidence: 99%

Characterization of Fusobacterium isolates from the respiratory tract of white-tailed deer (Odocoileus virginianus)

et al. 2014

Self Cite

View full text Add to dashboard Cite

Abstract.A total of 23 clinical isolates of Fusobacterium spp. were recovered at necropsy over a 2-year period from the respiratory tract of white-tailed deer (Odocoileus virginianus). Isolates were identified as Fusobacterium varium (18/23), Fusobacterium necrophorum subsp. funduliforme (3/23), and Fusobacterium necrophorum subsp. necrophorum (2/23). Using polymerase chain reaction-based detection of virulence genes, all F. necrophorum isolates were positive for the promoter region of the leukotoxin operon and the hemagglutinin-related protein gene, while all F. varium isolates were negative. The presence of the leukotoxin gene in F. necrophorum isolates and the absence of this gene in F. varium isolates were confirmed by Southern hybridization using 2 separate probes. Toxicity to bovine polymorphonuclear leukocytes was observed with all F. necrophorum isolates, but was not observed in any F. varium isolates. Susceptibility to antimicrobials was markedly different for F. varium as compared to F. necrophorum. In summary, no evidence of leukotoxin production was detected in any of the 23 F. varium isolates used in the current study. The data suggests that F. varium, the most common species isolated, may be a significant pathogen in deer with a different virulence mechanism than F. necrophorum. Tissue samples were cultured on prereduced Brucella agar plates b supplemented with 5% sheep blood, hemin (5 mg/l), and vitamin K (10 mg/l), and then incubated at 37°C for 48 hr in an anaerobic chamber. The 3-way antibiotic disk diffusion susceptibility test and nitrate test were conducted on Brucella agar plates with vancomycin, kanamycin, colistin, and nitrate disks.c Nitrate-negative isolates showing resistance to vancomycin and susceptibility to kanamycin and colistin were presumptively determined to be Fusobacterium sp.9 Following presumptive identification, the indole test was performed by placing 1 drop of indole reagent c onto an antibiotic disk. A pre-reduced McClung-Toabe egg yolk agar plate b was inoculated and incubated anaerobically at 37°C for 48-72 hr to determine lipase activity. Bile tolerance was determined by plating colonies onto pre-reduced Bacteroides fragilis isolation agar plates b containing 20% bile and incubating anaerobically at 37°C for 48-72 hr. Overnight cultures in prereduced anaerobically sterilized brain-heart infusion broth were observed for growth and sedimentation. All isolates were analyzed with commercial kits d,e according to the manufacturers' instructions. DNA extraction and 16S ribosomal DNA sequencingChromosomal DNA was extracted from all isolates. Briefly, cultures were grown anaerobically on pre-reduced blood agar plates at 37°C for 48-72 hr. The DNA was isolated using a commercial kit f according to the manufacturer's instructions. The extracts were stored at −20°C. Universal primers (p515FPL forward GCGGATCCTCTAGACT GCAGTGCCAGCAGCCGCGGTAA, and p13B reverse CGGGATCCCAGGCCCGGGAACGTATTCAC) were used to amplify a region of the 16S ribosomal RNA gene by polymerase chain reaction (P...

show abstract

Fusobacterium necrophorumLeukotoxin Induces Activation and Apoptosis of Bovine Leukocytes

Cited by 63 publications

References 39 publications

Human Infection withFusobacterium necrophorum(Necrobacillosis), with a Focus on Lemierre's Syndrome

Human Infection withFusobacterium necrophorum(Necrobacillosis), with a Focus on Lemierre's Syndrome

Fusobacterium nucleatum Increases Collagenase 3 Production and Migration of Epithelial Cells

Characterization of Fusobacterium isolates from the respiratory tract of white-tailed deer (Odocoileus virginianus)

Contact Info

Product

Resources

About